Incidental Mutation 'R1897:Vrk1'
ID271598
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
MMRRC Submission 039917-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R1897 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106036540 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312] [ENSMUST00000221485]
Predicted Effect probably benign
Transcript: ENSMUST00000021539
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072040
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085026
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220629
Predicted Effect probably benign
Transcript: ENSMUST00000221312
Predicted Effect probably benign
Transcript: ENSMUST00000221485
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc18 A T 5: 108,196,042 M884L probably benign Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw15 A T 9: 109,558,203 C188* probably null Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Hells T C 19: 38,940,484 V100A probably benign Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Synj2 T A 17: 6,022,137 C202* probably null Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r87 A T 10: 130,471,960 M803K probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
R8154:Vrk1 UTSW 12 106070534 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGATGATATGCCACTGGGACG -3'
(R):5'- CTCACCCAGATAGATGCAGC -3'

Sequencing Primer
(F):5'- ACGGACTCAACGTGCTTC -3'
(R):5'- GATGCAGCCAAAGCCACCTTG -3'
Posted On2015-03-23