Incidental Mutation 'R1594:Hmx2'
ID271611
Institutional Source Beutler Lab
Gene Symbol Hmx2
Ensembl Gene ENSMUSG00000050100
Gene NameH6 homeobox 2
SynonymsNkx5-2
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1594 (G1)
Quality Score64
Status Validated
Chromosome7
Chromosomal Location131548773-131558014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131555502 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000138799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051997] [ENSMUST00000084502] [ENSMUST00000124096] [ENSMUST00000183219] [ENSMUST00000207231] [ENSMUST00000207736]
Predicted Effect probably benign
Transcript: ENSMUST00000051997
AA Change: D115G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058205
Gene: ENSMUSG00000050100
AA Change: D115G

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084502
SMART Domains Protein: ENSMUSP00000081547
Gene: ENSMUSG00000066979

DomainStartEndE-ValueType
WD40 2 43 5.69e-4 SMART
WD40 46 83 8.91e-1 SMART
WD40 88 124 5.1e-6 SMART
WD40 127 163 6.16e0 SMART
WD40 214 262 4.02e-4 SMART
WD40 265 302 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183219
AA Change: D115G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138799
Gene: ENSMUSG00000050100
AA Change: D115G

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207231
Predicted Effect probably benign
Transcript: ENSMUST00000207736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209131
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NKL homeobox family of transcription factors. Members in this family are of ancient origin and play an important role in organ development during embryogenesis. A related mouse protein plays a role in patterning of inner ear structures. In humans, variations in a region containing this gene have been associated with inner ear malformations, vestibular dysfunction, and hearing loss. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous disruption of this gene results behavioral abnormalities, such as hyperactivity, head tilting and circling, as well as abnormal vestibular morphogenesis, including severe dysgenesis of all three semicircular ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Hmx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Hmx2 APN 7 131555672 missense probably damaging 1.00
R2142:Hmx2 UTSW 7 131555859 missense probably damaging 0.99
R5979:Hmx2 UTSW 7 131554550 missense probably benign
R6697:Hmx2 UTSW 7 131555934 missense probably damaging 0.99
R7132:Hmx2 UTSW 7 131555916 missense probably damaging 0.99
R7142:Hmx2 UTSW 7 131555736 missense probably damaging 0.99
R7426:Hmx2 UTSW 7 131554503 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTAATGTCCCCATTCCAGACCCG -3'
(R):5'- TCAGGTAGCGTTTCATGTCGAAGG -3'

Sequencing Primer
(F):5'- CTCCAGCTCGGATTATATGGAAC -3'
(R):5'- CGTTTCATGTCGAAGGTAGACTC -3'
Posted On2015-03-24