Incidental Mutation 'R3150:Col4a3'
ID 271612
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms tumstatin, alpha3(IV)
MMRRC Submission 040602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3150 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 82564647-82699778 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 82634858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
AlphaFold Q9QZS0
Predicted Effect probably null
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,313,590 (GRCm39) S178T possibly damaging Het
Cabin1 A G 10: 75,492,745 (GRCm39) L1850P probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Ces1g C T 8: 94,052,444 (GRCm39) V282I probably benign Het
Crat C T 2: 30,303,871 (GRCm39) probably null Het
Csf2ra C A 19: 61,215,758 (GRCm39) A16S possibly damaging Het
Cspg4b A T 13: 113,488,294 (GRCm39) Q105H probably damaging Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Ddb1 T A 19: 10,590,346 (GRCm39) M291K probably benign Het
Fcgbpl1 C A 7: 27,853,620 (GRCm39) T1528N probably benign Het
Gfod2 C T 8: 106,443,853 (GRCm39) G230D probably benign Het
Git2 A G 5: 114,868,410 (GRCm39) S257P probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Hnrnph1 T A 11: 50,276,619 (GRCm39) V439E probably benign Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Map3k20 C T 2: 72,202,336 (GRCm39) T189M probably damaging Het
Mapk11 T C 15: 89,029,653 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nmral1 G A 16: 4,534,333 (GRCm39) T36I probably damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or5b119 A G 19: 13,456,824 (GRCm39) V246A probably damaging Het
Or7e169 A G 9: 19,757,510 (GRCm39) I135T possibly damaging Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Pkd1 G T 17: 24,798,765 (GRCm39) R2691L probably benign Het
Ppp2r2a G A 14: 67,261,214 (GRCm39) R169W probably damaging Het
Prdm1 A T 10: 44,334,488 (GRCm39) probably null Het
Robo1 C T 16: 72,767,157 (GRCm39) P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,643,308 (GRCm39) probably benign Het
Shprh A G 10: 11,045,774 (GRCm39) H865R probably damaging Het
Spats1 A T 17: 45,775,480 (GRCm39) S15T probably damaging Het
Srgap2 T C 1: 131,220,327 (GRCm39) T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 (GRCm39) probably benign Het
Tie1 G A 4: 118,333,022 (GRCm39) A902V probably damaging Het
Usp22 T C 11: 61,051,407 (GRCm39) Q312R probably damaging Het
Vmn2r32 T C 7: 7,475,554 (GRCm39) Y443C probably benign Het
Vps13d A C 4: 144,813,360 (GRCm39) D3274E probably damaging Het
Wdr62 A T 7: 29,971,095 (GRCm39) N167K possibly damaging Het
Xpo5 A G 17: 46,553,173 (GRCm39) probably null Het
Zswim7 A T 11: 62,164,611 (GRCm39) I43N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82,675,475 (GRCm39) missense unknown
IGL00847:Col4a3 APN 1 82,695,590 (GRCm39) missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82,660,022 (GRCm39) missense unknown
IGL01102:Col4a3 APN 1 82,647,976 (GRCm39) missense unknown
IGL01102:Col4a3 APN 1 82,647,441 (GRCm39) missense unknown
IGL02071:Col4a3 APN 1 82,638,608 (GRCm39) critical splice donor site probably null
IGL02244:Col4a3 APN 1 82,647,492 (GRCm39) splice site probably benign
IGL02380:Col4a3 APN 1 82,650,509 (GRCm39) splice site probably benign
IGL02431:Col4a3 APN 1 82,657,344 (GRCm39) nonsense probably null
IGL02466:Col4a3 APN 1 82,647,913 (GRCm39) missense unknown
IGL02694:Col4a3 APN 1 82,688,515 (GRCm39) unclassified probably benign
IGL02709:Col4a3 APN 1 82,656,833 (GRCm39) missense unknown
IGL02752:Col4a3 APN 1 82,637,946 (GRCm39) missense unknown
IGL02792:Col4a3 APN 1 82,696,524 (GRCm39) missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82,650,360 (GRCm39) nonsense probably null
IGL03218:Col4a3 APN 1 82,620,927 (GRCm39) splice site probably benign
FR4976:Col4a3 UTSW 1 82,696,627 (GRCm39) frame shift probably null
PIT4260001:Col4a3 UTSW 1 82,660,482 (GRCm39) missense unknown
PIT4515001:Col4a3 UTSW 1 82,660,024 (GRCm39) missense unknown
R0035:Col4a3 UTSW 1 82,650,474 (GRCm39) missense unknown
R0099:Col4a3 UTSW 1 82,695,714 (GRCm39) missense probably benign 0.41
R0433:Col4a3 UTSW 1 82,647,940 (GRCm39) missense unknown
R0573:Col4a3 UTSW 1 82,694,084 (GRCm39) missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82,650,307 (GRCm39) splice site probably benign
R0715:Col4a3 UTSW 1 82,629,879 (GRCm39) splice site probably benign
R0961:Col4a3 UTSW 1 82,686,297 (GRCm39) splice site probably benign
R1257:Col4a3 UTSW 1 82,694,086 (GRCm39) missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82,621,022 (GRCm39) splice site probably benign
R1373:Col4a3 UTSW 1 82,667,808 (GRCm39) splice site probably benign
R1694:Col4a3 UTSW 1 82,668,384 (GRCm39) splice site probably null
R1895:Col4a3 UTSW 1 82,656,829 (GRCm39) missense unknown
R1925:Col4a3 UTSW 1 82,689,595 (GRCm39) unclassified probably benign
R1925:Col4a3 UTSW 1 82,678,094 (GRCm39) missense unknown
R2033:Col4a3 UTSW 1 82,695,732 (GRCm39) intron probably benign
R2044:Col4a3 UTSW 1 82,674,040 (GRCm39) missense unknown
R2122:Col4a3 UTSW 1 82,632,678 (GRCm39) missense unknown
R2282:Col4a3 UTSW 1 82,686,359 (GRCm39) missense unknown
R2318:Col4a3 UTSW 1 82,626,290 (GRCm39) splice site probably null
R2421:Col4a3 UTSW 1 82,647,996 (GRCm39) splice site probably benign
R2517:Col4a3 UTSW 1 82,658,431 (GRCm39) missense unknown
R2965:Col4a3 UTSW 1 82,626,321 (GRCm39) missense unknown
R3085:Col4a3 UTSW 1 82,628,979 (GRCm39) missense unknown
R3947:Col4a3 UTSW 1 82,693,053 (GRCm39) missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82,694,018 (GRCm39) critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82,650,400 (GRCm39) missense unknown
R4928:Col4a3 UTSW 1 82,688,698 (GRCm39) unclassified probably benign
R5044:Col4a3 UTSW 1 82,644,267 (GRCm39) missense unknown
R5557:Col4a3 UTSW 1 82,692,968 (GRCm39) unclassified probably benign
R5761:Col4a3 UTSW 1 82,693,778 (GRCm39) nonsense probably null
R5970:Col4a3 UTSW 1 82,694,050 (GRCm39) missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82,686,295 (GRCm39) splice site probably null
R6583:Col4a3 UTSW 1 82,619,197 (GRCm39) missense unknown
R6675:Col4a3 UTSW 1 82,646,646 (GRCm39) missense unknown
R7170:Col4a3 UTSW 1 82,693,630 (GRCm39) splice site probably null
R7592:Col4a3 UTSW 1 82,626,338 (GRCm39) missense unknown
R7624:Col4a3 UTSW 1 82,696,605 (GRCm39) missense probably benign
R7994:Col4a3 UTSW 1 82,640,627 (GRCm39) missense unknown
R8127:Col4a3 UTSW 1 82,627,481 (GRCm39) missense unknown
R8702:Col4a3 UTSW 1 82,688,700 (GRCm39) missense unknown
R8865:Col4a3 UTSW 1 82,647,483 (GRCm39) critical splice donor site probably null
R8973:Col4a3 UTSW 1 82,693,052 (GRCm39) missense probably benign 0.11
R9611:Col4a3 UTSW 1 82,678,018 (GRCm39) missense unknown
R9665:Col4a3 UTSW 1 82,668,301 (GRCm39) missense unknown
R9765:Col4a3 UTSW 1 82,646,678 (GRCm39) nonsense probably null
X0067:Col4a3 UTSW 1 82,693,880 (GRCm39) missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82,667,760 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTCATTCACTGGCCAT -3'
(R):5'- TGGATCAGAGCCACACATACT -3'

Sequencing Primer
(F):5'- CCATGTTGGAATGAGCACTTTC -3'
(R):5'- ATGGCTGGGTGAGTGTAAA -3'
Posted On 2015-03-25