Mutagenetix > Incidental Mutations

Incidental Mutation 'R3150:Padi6'

271620

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

040602-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3150 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140735389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 307 (L307P)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably damaging
Transcript: ENSMUST00000038749
AA Change: L307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: L307P

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Predicted Effect

probably benign
Transcript: ENSMUST00000130267

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Meta Mutation Damage Score

0.1502

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	A	7: 28,154,195	T1528N	probably benign	Het
Akna	A	T	4: 63,395,353	S178T	possibly damaging	Het
BC067074	A	T	13: 113,351,760	Q105H	probably damaging	Het
Cabin1	A	G	10: 75,656,911	L1850P	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Ces1g	C	T	8: 93,325,816	V282I	probably benign	Het
Col4a3	T	G	1: 82,657,137		probably null	Het
Crat	C	T	2: 30,413,859		probably null	Het
Csf2ra	C	A	19: 61,227,320	A16S	possibly damaging	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Ddb1	T	A	19: 10,612,982	M291K	probably benign	Het
Gfod2	C	T	8: 105,717,221	G230D	probably benign	Het
Git2	A	G	5: 114,730,349	S257P	probably damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Hnrnph1	T	A	11: 50,385,792	V439E	probably benign	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Map3k20	C	T	2: 72,371,992	T189M	probably damaging	Het
Mapk11	T	C	15: 89,145,450		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nmral1	G	A	16: 4,716,469	T36I	probably damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1475	A	G	19: 13,479,460	V246A	probably damaging	Het
Olfr860	A	G	9: 19,846,214	I135T	possibly damaging	Het
Pkd1	G	T	17: 24,579,791	R2691L	probably benign	Het
Ppp2r2a	G	A	14: 67,023,765	R169W	probably damaging	Het
Prdm1	A	T	10: 44,458,492		probably null	Het
Robo1	C	T	16: 72,970,269	P443L	possibly damaging	Het
Rtn4	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	11: 29,693,308		probably benign	Het
Shprh	A	G	10: 11,170,030	H865R	probably damaging	Het
Spats1	A	T	17: 45,464,554	S15T	probably damaging	Het
Srgap2	T	C	1: 131,292,589	T216A	probably benign	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
Tie1	G	A	4: 118,475,825	A902V	probably damaging	Het
Usp22	T	C	11: 61,160,581	Q312R	probably damaging	Het
Vmn2r32	T	C	7: 7,472,555	Y443C	probably benign	Het
Vps13d	A	C	4: 145,086,790	D3274E	probably damaging	Het
Wdr62	A	T	7: 30,271,670	N167K	possibly damaging	Het
Xpo5	A	G	17: 46,242,247		probably null	Het
Zswim7	A	T	11: 62,273,785	I43N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATGAGTCACGACTGGAAGTG -3'
(R):5'- ACTGAAGCTCTCGGTACAGC -3'

Sequencing Primer
(F):5'- TGGAAGTGTCCCCACAACTG -3'
(R):5'- GTGTTAACAGAAAGCAGGCTC -3'

Posted On

2015-03-25