Incidental Mutation 'R3150:Padi6'
ID271620
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Namepeptidyl arginine deiminase, type VI
SynonymsPadi5, Pad6, ePAD
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140727355-140742643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140735389 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 307 (L307P)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
Predicted Effect probably damaging
Transcript: ENSMUST00000038749
AA Change: L307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: L307P

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125046
Predicted Effect probably benign
Transcript: ENSMUST00000130267
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAGTCACGACTGGAAGTG -3'
(R):5'- ACTGAAGCTCTCGGTACAGC -3'

Sequencing Primer
(F):5'- TGGAAGTGTCCCCACAACTG -3'
(R):5'- GTGTTAACAGAAAGCAGGCTC -3'
Posted On2015-03-25