Mutagenetix > Incidental Mutations

Incidental Mutation 'R3150:Gm5592'

271628

Institutional Source

Beutler Lab

Gene Symbol

Gm5592

Ensembl Gene

ENSMUSG00000072259

Gene Name

predicted gene 5592

Synonyms

MMRRC Submission

040602-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R3150 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41153841-41290183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41288380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 362 (E362G)

Ref Sequence

ENSEMBL: ENSMUSP00000145899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]

AlphaFold

Q3V0A6

Predicted Effect

probably benign
Transcript: ENSMUST00000097044
AA Change: E362G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: E362G

Domain	Start	End	E-Value	Type
Pfam:DUF4629	435	580	6.1e-60	PFAM
low complexity region	607	612	N/A	INTRINSIC
low complexity region	708	725	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206040

Predicted Effect

probably benign
Transcript: ENSMUST00000206490
AA Change: E362G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	A	7: 28,154,195	T1528N	probably benign	Het
Akna	A	T	4: 63,395,353	S178T	possibly damaging	Het
BC067074	A	T	13: 113,351,760	Q105H	probably damaging	Het
Cabin1	A	G	10: 75,656,911	L1850P	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Ces1g	C	T	8: 93,325,816	V282I	probably benign	Het
Col4a3	T	G	1: 82,657,137		probably null	Het
Crat	C	T	2: 30,413,859		probably null	Het
Csf2ra	C	A	19: 61,227,320	A16S	possibly damaging	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Ddb1	T	A	19: 10,612,982	M291K	probably benign	Het
Gfod2	C	T	8: 105,717,221	G230D	probably benign	Het
Git2	A	G	5: 114,730,349	S257P	probably damaging	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Hnrnph1	T	A	11: 50,385,792	V439E	probably benign	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Map3k20	C	T	2: 72,371,992	T189M	probably damaging	Het
Mapk11	T	C	15: 89,145,450		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nmral1	G	A	16: 4,716,469	T36I	probably damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1475	A	G	19: 13,479,460	V246A	probably damaging	Het
Olfr860	A	G	9: 19,846,214	I135T	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pkd1	G	T	17: 24,579,791	R2691L	probably benign	Het
Ppp2r2a	G	A	14: 67,023,765	R169W	probably damaging	Het
Prdm1	A	T	10: 44,458,492		probably null	Het
Robo1	C	T	16: 72,970,269	P443L	possibly damaging	Het
Rtn4	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	11: 29,693,308		probably benign	Het
Shprh	A	G	10: 11,170,030	H865R	probably damaging	Het
Spats1	A	T	17: 45,464,554	S15T	probably damaging	Het
Srgap2	T	C	1: 131,292,589	T216A	probably benign	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
Tie1	G	A	4: 118,475,825	A902V	probably damaging	Het
Usp22	T	C	11: 61,160,581	Q312R	probably damaging	Het
Vmn2r32	T	C	7: 7,472,555	Y443C	probably benign	Het
Vps13d	A	C	4: 145,086,790	D3274E	probably damaging	Het
Wdr62	A	T	7: 30,271,670	N167K	possibly damaging	Het
Xpo5	A	G	17: 46,242,247		probably null	Het
Zswim7	A	T	11: 62,273,785	I43N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Gm5592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Gm5592	APN	7	41289095	missense	probably damaging	1.00
IGL01472:Gm5592	APN	7	41286074	splice site	probably benign
IGL01718:Gm5592	APN	7	41289193	missense	probably damaging	0.99
IGL01981:Gm5592	APN	7	41286371	nonsense	probably null
IGL02318:Gm5592	APN	7	41286788	missense	probably benign	0.37
IGL02346:Gm5592	APN	7	41289465	missense	probably damaging	0.97
IGL02904:Gm5592	APN	7	41288386	missense	probably damaging	1.00
I1329:Gm5592	UTSW	7	41286354	nonsense	probably null
R0465:Gm5592	UTSW	7	41156057	intron	probably benign
R0669:Gm5592	UTSW	7	41155830	intron	probably benign
R0675:Gm5592	UTSW	7	41289387	missense	possibly damaging	0.81
R1381:Gm5592	UTSW	7	41286172	missense	probably benign
R1731:Gm5592	UTSW	7	41288413	missense	probably damaging	0.99
R3149:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3176:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3177:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3276:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3277:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3623:Gm5592	UTSW	7	41157628	intron	probably benign
R3797:Gm5592	UTSW	7	41157835	intron	probably benign
R3854:Gm5592	UTSW	7	41157835	intron	probably benign
R3856:Gm5592	UTSW	7	41157835	intron	probably benign
R4009:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4010:Gm5592	UTSW	7	41286628	missense	probably benign	0.05
R4011:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4127:Gm5592	UTSW	7	41289067	missense	probably benign	0.00
R4162:Gm5592	UTSW	7	41217778	intron	probably benign
R4289:Gm5592	UTSW	7	41158912	intron	probably benign
R4304:Gm5592	UTSW	7	41286262	missense	probably benign	0.20
R4332:Gm5592	UTSW	7	41216118	intron	probably benign
R4408:Gm5592	UTSW	7	41286448	missense	probably benign	0.04
R4572:Gm5592	UTSW	7	41216159	intron	probably benign
R4764:Gm5592	UTSW	7	41216118	intron	probably benign
R4822:Gm5592	UTSW	7	41155890	intron	probably benign
R4836:Gm5592	UTSW	7	41215534	intron	probably benign
R4854:Gm5592	UTSW	7	41217471	intron	probably benign
R5032:Gm5592	UTSW	7	41289735	missense	probably damaging	1.00
R5075:Gm5592	UTSW	7	41158963	intron	probably benign
R5369:Gm5592	UTSW	7	41218211	intron	probably benign
R5424:Gm5592	UTSW	7	41155593	intron	probably benign
R5700:Gm5592	UTSW	7	41158579	intron	probably benign
R5741:Gm5592	UTSW	7	41289201	missense	probably benign
R5802:Gm5592	UTSW	7	41219105	intron	probably benign
R5945:Gm5592	UTSW	7	41215612	intron	probably benign
R6117:Gm5592	UTSW	7	41288464	missense	probably benign	0.00
R6324:Gm5592	UTSW	7	41286535	missense	probably damaging	0.98
R6449:Gm5592	UTSW	7	41288586	missense	probably benign	0.09
R6571:Gm5592	UTSW	7	41288575	missense	probably damaging	0.98
R6776:Gm5592	UTSW	7	41289729	missense	probably damaging	1.00
R7595:Gm5592	UTSW	7	41286443	missense	probably damaging	0.99
R7658:Gm5592	UTSW	7	41288710	missense	probably benign	0.03
R7699:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7700:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7774:Gm5592	UTSW	7	41289859	missense	probably damaging	1.00
R7788:Gm5592	UTSW	7	41286694	missense	probably benign	0.01
R7890:Gm5592	UTSW	7	41286759	missense	probably damaging	1.00
R8070:Gm5592	UTSW	7	41286463	missense	possibly damaging	0.76
R8417:Gm5592	UTSW	7	41288551	missense	probably benign	0.38
R8866:Gm5592	UTSW	7	41288822	missense	possibly damaging	0.74
R9044:Gm5592	UTSW	7	41288850	missense	probably benign	0.25
R9057:Gm5592	UTSW	7	41289463	missense	possibly damaging	0.93
R9258:Gm5592	UTSW	7	41288983	missense	possibly damaging	0.56
X0021:Gm5592	UTSW	7	41288508	missense	probably benign	0.01
Z1176:Gm5592	UTSW	7	41286317	missense	probably damaging	1.00
Z1176:Gm5592	UTSW	7	41286319	missense	possibly damaging	0.94
Z1176:Gm5592	UTSW	7	41288681	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGACAAGGCATTAACAGCC -3'
(R):5'- ACTGTCCAGGTTTCACAGGAC -3'

Sequencing Primer
(F):5'- CCCCATCCACAGTCCTTCAGAG -3'
(R):5'- GTCCAGGTTTCACAGGACTGATC -3'

Posted On

2015-03-25