Incidental Mutation 'R3150:Ces1g'
ID271631
Institutional Source Beutler Lab
Gene Symbol Ces1g
Ensembl Gene ENSMUSG00000057074
Gene Namecarboxylesterase 1G
SynonymsSes-1, Ces1, Ces-1
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93302369-93337308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93325816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 282 (V282I)
Ref Sequence ENSEMBL: ENSMUSP00000037555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044602]
Predicted Effect probably benign
Transcript: ENSMUST00000044602
AA Change: V282I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: V282I

DomainStartEndE-ValueType
Pfam:COesterase 1 545 3.6e-168 PFAM
Pfam:Abhydrolase_3 136 295 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Ces1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ces1g APN 8 93302987 missense possibly damaging 0.61
IGL00971:Ces1g APN 8 93303032 missense probably damaging 1.00
IGL01583:Ces1g APN 8 93306959 missense probably damaging 1.00
IGL02993:Ces1g APN 8 93317079 missense probably benign 0.00
IGL03386:Ces1g APN 8 93325812 missense probably benign 0.00
R0359:Ces1g UTSW 8 93328535 splice site probably benign
R0373:Ces1g UTSW 8 93331193 missense probably benign 0.06
R0499:Ces1g UTSW 8 93333689 missense probably benign 0.01
R0689:Ces1g UTSW 8 93328407 missense probably damaging 1.00
R1756:Ces1g UTSW 8 93306954 missense probably benign 0.03
R3052:Ces1g UTSW 8 93335048 missense possibly damaging 0.50
R3899:Ces1g UTSW 8 93303050 missense probably damaging 1.00
R3966:Ces1g UTSW 8 93328511 missense possibly damaging 0.50
R4134:Ces1g UTSW 8 93319872 missense probably benign 0.00
R4198:Ces1g UTSW 8 93305868 missense probably benign 0.11
R4332:Ces1g UTSW 8 93319818 missense probably benign 0.01
R4719:Ces1g UTSW 8 93317090 missense possibly damaging 0.59
R4841:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4842:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4843:Ces1g UTSW 8 93331265 missense probably damaging 1.00
R5344:Ces1g UTSW 8 93337193 start gained probably benign
R5405:Ces1g UTSW 8 93305868 missense probably benign 0.29
R5425:Ces1g UTSW 8 93325800 missense probably benign 0.20
R5884:Ces1g UTSW 8 93306930 missense probably benign 0.24
R6022:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R6183:Ces1g UTSW 8 93331239 missense possibly damaging 0.48
R6197:Ces1g UTSW 8 93337136 missense probably benign 0.01
R6307:Ces1g UTSW 8 93331192 missense possibly damaging 0.60
R6688:Ces1g UTSW 8 93306972 missense possibly damaging 0.92
R6863:Ces1g UTSW 8 93317019 missense possibly damaging 0.92
R7097:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7122:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7180:Ces1g UTSW 8 93302948 missense probably benign 0.04
R7202:Ces1g UTSW 8 93302967 missense probably benign 0.01
R7361:Ces1g UTSW 8 93333679 missense not run
R7537:Ces1g UTSW 8 93319827 missense probably benign 0.01
R7621:Ces1g UTSW 8 93328466 missense probably damaging 1.00
R8200:Ces1g UTSW 8 93328457 missense probably damaging 1.00
Z1176:Ces1g UTSW 8 93325811 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAAGACTGACACCGTCCTG -3'
(R):5'- TTGGGTAGCCATCTCACACC -3'

Sequencing Primer
(F):5'- CCGTCCTGAAAGATAACAACTATTTC -3'
(R):5'- AGAGCTTACACTCTGGTACCTAG -3'
Posted On2015-03-25