Incidental Mutation 'R3150:Olfr860'
ID271633
Institutional Source Beutler Lab
Gene Symbol Olfr860
Ensembl Gene ENSMUSG00000066905
Gene Nameolfactory receptor 860
SynonymsMOR146-2, GA_x6K02T2PVTD-13586614-13585661
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19845156-19849747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19846214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000148658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086482] [ENSMUST00000211924] [ENSMUST00000212353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086482
AA Change: I135T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130735
Gene: ENSMUSG00000066905
AA Change: I135T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.5e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-8 PFAM
Pfam:7tm_1 41 290 9.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211924
AA Change: I135T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212353
AA Change: I135T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212525
AA Change: I135T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212838
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Olfr860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Olfr860 APN 9 19846259 missense probably damaging 1.00
IGL02216:Olfr860 APN 9 19846565 missense probably damaging 0.99
IGL02269:Olfr860 APN 9 19845728 missense possibly damaging 0.85
IGL02964:Olfr860 APN 9 19846254 nonsense probably null
R0042:Olfr860 UTSW 9 19845779 missense probably benign
R1505:Olfr860 UTSW 9 19845788 missense probably benign 0.39
R1941:Olfr860 UTSW 9 19845950 missense probably damaging 0.99
R2030:Olfr860 UTSW 9 19846413 missense probably benign 0.30
R4597:Olfr860 UTSW 9 19845691 missense probably benign 0.01
R5004:Olfr860 UTSW 9 19846102 missense probably benign 0.00
R5006:Olfr860 UTSW 9 19846271 missense probably benign 0.33
R5350:Olfr860 UTSW 9 19846616 start codon destroyed probably null 0.97
R6163:Olfr860 UTSW 9 19845728 missense probably benign 0.45
R6368:Olfr860 UTSW 9 19846409 missense probably damaging 1.00
R7206:Olfr860 UTSW 9 19846560 missense probably damaging 0.99
R7315:Olfr860 UTSW 9 19845835 missense probably damaging 0.99
R8195:Olfr860 UTSW 9 19846484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGAATCCAACAATGATACTGAC -3'
(R):5'- TCTGACATGGGCTTCAGCAG -3'

Sequencing Primer
(F):5'- CTATTTATAGAGGTGTCAGAACAGGC -3'
(R):5'- TTCAGCAGCACCACCATC -3'
Posted On2015-03-25