Incidental Mutation 'R3150:Hnrnph1'
ID271638
Institutional Source Beutler Lab
Gene Symbol Hnrnph1
Ensembl Gene ENSMUSG00000007850
Gene Nameheterogeneous nuclear ribonucleoprotein H1
SynonymsE430005G16Rik, Hnrph1
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50376990-50386528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50385792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 439 (V439E)
Ref Sequence ENSEMBL: ENSMUSP00000076989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643] [ENSMUST00000069304] [ENSMUST00000077817] [ENSMUST00000109142]
Predicted Effect probably benign
Transcript: ENSMUST00000020643
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069304
SMART Domains Protein: ENSMUSP00000070503
Gene: ENSMUSG00000007850

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077817
AA Change: V439E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076989
Gene: ENSMUSG00000007850
AA Change: V439E

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109142
SMART Domains Protein: ENSMUSP00000104770
Gene: ENSMUSG00000007850

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141668
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Hnrnph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Hnrnph1 UTSW 11 50385762 splice site probably benign
R2172:Hnrnph1 UTSW 11 50382816 missense probably benign 0.11
R4908:Hnrnph1 UTSW 11 50378410 missense probably damaging 0.97
R5661:Hnrnph1 UTSW 11 50384680 missense probably benign
R6194:Hnrnph1 UTSW 11 50383277 missense possibly damaging 0.89
R7501:Hnrnph1 UTSW 11 50379556 missense probably benign 0.00
R7650:Hnrnph1 UTSW 11 50383899 missense probably benign
R7745:Hnrnph1 UTSW 11 50379497 missense probably damaging 1.00
R8172:Hnrnph1 UTSW 11 50379905 missense probably damaging 0.99
X0021:Hnrnph1 UTSW 11 50379479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCAAGTTGGTACTGCAG -3'
(R):5'- AGGCTGGATGGATTGCAAAATC -3'

Sequencing Primer
(F):5'- TACTGCAGAGAAAAGGGTTTAATTG -3'
(R):5'- TTGCAAAATCTGTTAAACTGAGGGG -3'
Posted On2015-03-25