Incidental Mutation 'R3150:Usp22'
ID271639
Institutional Source Beutler Lab
Gene Symbol Usp22
Ensembl Gene ENSMUSG00000042506
Gene Nameubiquitin specific peptidase 22
Synonyms
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61151785-61175055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61160581 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 312 (Q312R)
Ref Sequence ENSEMBL: ENSMUSP00000041263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041683] [ENSMUST00000174301]
Predicted Effect probably damaging
Transcript: ENSMUST00000041683
AA Change: Q312R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041263
Gene: ENSMUSG00000042506
AA Change: Q312R

DomainStartEndE-ValueType
Pfam:zf-UBP 63 124 5.5e-16 PFAM
Pfam:UCH 175 517 5.5e-60 PFAM
Pfam:UCH_1 176 501 2.8e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174220
Predicted Effect probably benign
Transcript: ENSMUST00000174301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, embryonic growth retardation, and increased apoptosis in mouse embryonic fibroblasts. Homozygotes for a hypomorphic allele are viable but show postnatal growth retardation, and impaired cell differentiation in the small intestine and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Usp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Usp22 APN 11 61155288 missense probably damaging 0.99
IGL02021:Usp22 APN 11 61154499 missense probably damaging 1.00
R0230:Usp22 UTSW 11 61159197 unclassified probably benign
R1635:Usp22 UTSW 11 61161318 nonsense probably null
R2198:Usp22 UTSW 11 61159337 missense probably damaging 0.97
R4296:Usp22 UTSW 11 61161464 splice site probably null
R4618:Usp22 UTSW 11 61161443 missense probably damaging 0.96
R4764:Usp22 UTSW 11 61160636 missense probably damaging 0.98
R4979:Usp22 UTSW 11 61157216 missense probably damaging 1.00
R5620:Usp22 UTSW 11 61158380 missense probably damaging 1.00
R6191:Usp22 UTSW 11 61174776 missense probably benign 0.24
R6750:Usp22 UTSW 11 61157216 missense probably damaging 1.00
R7129:Usp22 UTSW 11 61162949 missense probably damaging 0.98
R7991:Usp22 UTSW 11 61174762 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTGAAACTAGTGTAGGTGCTCCAC -3'
(R):5'- GAGTGTTAGTCCTCCTGCTG -3'

Sequencing Primer
(F):5'- TCCACCATGAGCACCACAGG -3'
(R):5'- TCCCACCTCTGCTGGGTG -3'
Posted On2015-03-25