Incidental Mutation 'R3150:Gpatch2l'
ID271642
Institutional Source Beutler Lab
Gene Symbol Gpatch2l
Ensembl Gene ENSMUSG00000021254
Gene NameG patch domain containing 2 like
Synonyms1700020O03Rik
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3150 (G1)
Quality Score223
Status Not validated
Chromosome12
Chromosomal Location86241858-86291784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86244315 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000152284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000221368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071106
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221368
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Gpatch2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02335:Gpatch2l APN 12 86256937 splice site probably benign
IGL02458:Gpatch2l APN 12 86288961 utr 3 prime probably benign
IGL03131:Gpatch2l APN 12 86281511 missense probably benign 0.00
R0546:Gpatch2l UTSW 12 86288848 makesense probably null
R1349:Gpatch2l UTSW 12 86260709 missense possibly damaging 0.94
R1368:Gpatch2l UTSW 12 86260665 missense possibly damaging 0.73
R1600:Gpatch2l UTSW 12 86256934 critical splice donor site probably null
R1701:Gpatch2l UTSW 12 86288952 missense probably benign 0.00
R2656:Gpatch2l UTSW 12 86288810 missense probably damaging 1.00
R3149:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3176:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3177:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3276:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3277:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R4342:Gpatch2l UTSW 12 86260679 missense probably benign 0.00
R5161:Gpatch2l UTSW 12 86267176 missense probably benign 0.17
R5712:Gpatch2l UTSW 12 86244480 missense probably damaging 1.00
R6343:Gpatch2l UTSW 12 86260605 nonsense probably null
R6899:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6910:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6911:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6912:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6917:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6930:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6994:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6995:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6996:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6998:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6999:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7000:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7001:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7002:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7003:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7010:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7011:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7203:Gpatch2l UTSW 12 86288937 missense probably benign 0.40
R7239:Gpatch2l UTSW 12 86260575 critical splice acceptor site probably null
R7327:Gpatch2l UTSW 12 86256872 missense probably damaging 1.00
R7419:Gpatch2l UTSW 12 86265251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCGGAGCAGAGCAAGCTTG -3'
(R):5'- GCTTCTTGGCAGACTTGAAC -3'

Sequencing Primer
(F):5'- TGAGCCCCAGACAGCAGAG -3'
(R):5'- GACTTGAACCTGCAGCCTC -3'
Posted On2015-03-25