Incidental Mutation 'R3150:Ddb1'
ID 271654
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Name damage specific DNA binding protein 1
Synonyms damage-specific DNA-binding protein, DNA repair, p127-Ddb1, DNA repair protein
MMRRC Submission 040602-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3150 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 10582961-10607186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10590346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 291 (M291K)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
AlphaFold Q3U1J4
Predicted Effect probably benign
Transcript: ENSMUST00000025649
AA Change: M291K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: M291K

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,313,590 (GRCm39) S178T possibly damaging Het
Cabin1 A G 10: 75,492,745 (GRCm39) L1850P probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Ces1g C T 8: 94,052,444 (GRCm39) V282I probably benign Het
Col4a3 T G 1: 82,634,858 (GRCm39) probably null Het
Crat C T 2: 30,303,871 (GRCm39) probably null Het
Csf2ra C A 19: 61,215,758 (GRCm39) A16S possibly damaging Het
Cspg4b A T 13: 113,488,294 (GRCm39) Q105H probably damaging Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Fcgbpl1 C A 7: 27,853,620 (GRCm39) T1528N probably benign Het
Gfod2 C T 8: 106,443,853 (GRCm39) G230D probably benign Het
Git2 A G 5: 114,868,410 (GRCm39) S257P probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Hnrnph1 T A 11: 50,276,619 (GRCm39) V439E probably benign Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Map3k20 C T 2: 72,202,336 (GRCm39) T189M probably damaging Het
Mapk11 T C 15: 89,029,653 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nmral1 G A 16: 4,534,333 (GRCm39) T36I probably damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or5b119 A G 19: 13,456,824 (GRCm39) V246A probably damaging Het
Or7e169 A G 9: 19,757,510 (GRCm39) I135T possibly damaging Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Pkd1 G T 17: 24,798,765 (GRCm39) R2691L probably benign Het
Ppp2r2a G A 14: 67,261,214 (GRCm39) R169W probably damaging Het
Prdm1 A T 10: 44,334,488 (GRCm39) probably null Het
Robo1 C T 16: 72,767,157 (GRCm39) P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,643,308 (GRCm39) probably benign Het
Shprh A G 10: 11,045,774 (GRCm39) H865R probably damaging Het
Spats1 A T 17: 45,775,480 (GRCm39) S15T probably damaging Het
Srgap2 T C 1: 131,220,327 (GRCm39) T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 (GRCm39) probably benign Het
Tie1 G A 4: 118,333,022 (GRCm39) A902V probably damaging Het
Usp22 T C 11: 61,051,407 (GRCm39) Q312R probably damaging Het
Vmn2r32 T C 7: 7,475,554 (GRCm39) Y443C probably benign Het
Vps13d A C 4: 144,813,360 (GRCm39) D3274E probably damaging Het
Wdr62 A T 7: 29,971,095 (GRCm39) N167K possibly damaging Het
Xpo5 A G 17: 46,553,173 (GRCm39) probably null Het
Zswim7 A T 11: 62,164,611 (GRCm39) I43N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10,589,028 (GRCm39) missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10,588,124 (GRCm39) missense probably benign
IGL01161:Ddb1 APN 19 10,583,071 (GRCm39) start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10,605,024 (GRCm39) critical splice donor site probably null
IGL01804:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10,604,996 (GRCm39) missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10,599,830 (GRCm39) missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10,585,247 (GRCm39) missense probably benign
IGL03033:Ddb1 APN 19 10,603,290 (GRCm39) missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10,599,225 (GRCm39) missense probably benign 0.01
Dubitable UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
Indubitable UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
Van_der_waals UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10,603,334 (GRCm39) missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10,596,610 (GRCm39) missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10,599,080 (GRCm39) missense probably benign 0.02
R0893:Ddb1 UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
R1374:Ddb1 UTSW 19 10,585,682 (GRCm39) missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10,604,128 (GRCm39) critical splice donor site probably null
R1611:Ddb1 UTSW 19 10,590,252 (GRCm39) missense probably damaging 1.00
R1661:Ddb1 UTSW 19 10,606,444 (GRCm39) missense probably benign 0.00
R1835:Ddb1 UTSW 19 10,603,957 (GRCm39) missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10,588,186 (GRCm39) splice site probably benign
R2094:Ddb1 UTSW 19 10,590,300 (GRCm39) missense probably benign
R2142:Ddb1 UTSW 19 10,596,490 (GRCm39) critical splice donor site probably null
R2213:Ddb1 UTSW 19 10,585,691 (GRCm39) missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10,603,992 (GRCm39) missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10,584,337 (GRCm39) missense probably benign 0.03
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10,605,857 (GRCm39) missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10,605,171 (GRCm39) missense probably benign 0.00
R5157:Ddb1 UTSW 19 10,599,728 (GRCm39) missense probably benign 0.01
R6244:Ddb1 UTSW 19 10,603,287 (GRCm39) missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10,583,084 (GRCm39) nonsense probably null
R6812:Ddb1 UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
R7337:Ddb1 UTSW 19 10,605,195 (GRCm39) missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
R7737:Ddb1 UTSW 19 10,603,338 (GRCm39) missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8288:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8376:Ddb1 UTSW 19 10,596,669 (GRCm39) missense probably damaging 1.00
R8970:Ddb1 UTSW 19 10,585,808 (GRCm39) missense probably benign 0.01
R9720:Ddb1 UTSW 19 10,585,724 (GRCm39) missense probably benign
RF016:Ddb1 UTSW 19 10,605,222 (GRCm39) missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10,604,023 (GRCm39) missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10,596,594 (GRCm39) missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10,585,760 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAAGTAAGGGCTCCTAGTTTAC -3'
(R):5'- GCTAACTCTTTCAGAAACCAACTTC -3'

Sequencing Primer
(F):5'- GGGCTCCTAGTTTACAAGATCTGAC -3'
(R):5'- CAGAAACCAACTTCTTGCTGGATGG -3'
Posted On 2015-03-25