Incidental Mutation 'R3150:Csf2ra'
ID271656
Institutional Source Beutler Lab
Gene Symbol Csf2ra
Ensembl Gene ENSMUSG00000059326
Gene Namecolony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
SynonymsCsfgmra, CD116, GM-CSFRalpha, GM-CSF-Ra
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location61224402-61228418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61227320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 16 (A16S)
Ref Sequence ENSEMBL: ENSMUSP00000075423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076046
AA Change: A16S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075423
Gene: ENSMUSG00000059326
AA Change: A16S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:IL6Ra-bind 129 223 5.2e-23 PFAM
FN3 226 311 9.19e-1 SMART
transmembrane domain 326 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Tie1 G A 4: 118,475,825 A902V probably damaging Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Csf2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Csf2ra APN 19 61226833 missense possibly damaging 0.87
IGL01465:Csf2ra APN 19 61225998 missense possibly damaging 0.95
IGL01693:Csf2ra APN 19 61225996 missense possibly damaging 0.57
IGL02474:Csf2ra APN 19 61226537 missense possibly damaging 0.95
IGL02950:Csf2ra APN 19 61227169 missense probably benign 0.01
R0054:Csf2ra UTSW 19 61226597 missense probably damaging 1.00
R0201:Csf2ra UTSW 19 61225568 missense probably benign 0.14
R0452:Csf2ra UTSW 19 61226895 missense probably benign 0.02
R1735:Csf2ra UTSW 19 61226344 missense probably damaging 0.99
R2016:Csf2ra UTSW 19 61226893 missense probably benign 0.01
R2157:Csf2ra UTSW 19 61227071 missense probably benign 0.05
R3149:Csf2ra UTSW 19 61227320 missense possibly damaging 0.83
R4747:Csf2ra UTSW 19 61226053 nonsense probably null
R4825:Csf2ra UTSW 19 61226552 missense probably benign 0.10
R5580:Csf2ra UTSW 19 61226217 missense probably damaging 1.00
R5831:Csf2ra UTSW 19 61225212 missense probably damaging 1.00
R5887:Csf2ra UTSW 19 61227328 missense possibly damaging 0.92
R7105:Csf2ra UTSW 19 61225020 missense possibly damaging 0.61
R7123:Csf2ra UTSW 19 61226862 missense probably damaging 1.00
R7419:Csf2ra UTSW 19 61227053 missense possibly damaging 0.94
R7721:Csf2ra UTSW 19 61226586 missense probably damaging 1.00
Z1177:Csf2ra UTSW 19 61225153 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGACATCATTGCGGGACAAG -3'
(R):5'- AAAGCGGGTCCACATATAAGC -3'

Sequencing Primer
(F):5'- TCACGGTGCATGACGTCAC -3'
(R):5'- GCGGGTCCACATATAAGCAAAGATTC -3'
Posted On2015-03-25