Incidental Mutation 'R3425:Ptpn4'
ID271715
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119707830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 381 (D381G)
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435]
Predicted Effect probably benign
Transcript: ENSMUST00000064091
AA Change: D381G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: D381G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163435
AA Change: D381G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: D381G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168808
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGCAATGTTTGAGGCAAC -3'
(R):5'- TTCTGAGTACAGTAGCTACAAGCAAAG -3'

Sequencing Primer
(F):5'- CAAGCCTGAGTACTTGGTTGCAATC -3'
(R):5'- TGCAATTTGAGAAAATGTTTGATAGC -3'
Posted On2015-03-25