Incidental Mutation 'R3425:Olfr1098'
ID271718
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Nameolfactory receptor 1098
SynonymsMOR206-1, GA_x6K02T2Q125-48410458-48409511
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86920949-86924545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86922606 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 309 (E309K)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
Predicted Effect probably benign
Transcript: ENSMUST00000099872
AA Change: E309K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: E309K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111574
AA Change: E309K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: E309K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 splice site probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R2368:Olfr1098 UTSW 2 86923107 missense probably benign
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4156:Olfr1098 UTSW 2 86922878 missense probably damaging 1.00
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R5942:Olfr1098 UTSW 2 86923406 missense probably damaging 1.00
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6517:Olfr1098 UTSW 2 86923097 missense probably benign 0.05
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
R8058:Olfr1098 UTSW 2 86922807 missense probably benign 0.32
R8234:Olfr1098 UTSW 2 86922969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCCATTCTGAGATATGCCC -3'
(R):5'- CTTCTTCAGGAAAGCACAAAGC -3'

Sequencing Primer
(F):5'- GCCCAAACTATATTTTTCTAGGGGAG -3'
(R):5'- TGTGCCTCACATCTTATAGGAG -3'
Posted On2015-03-25