Mutagenetix > Incidental Mutation

Incidental Mutation 'R3425:Il16'

271722

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

040643-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R3425 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83292033-83394934 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83293248 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 575 (E575G)

Ref Sequence

ENSEMBL: ENSMUSP00000146496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000075418] [ENSMUST00000117410] [ENSMUST00000145610]

AlphaFold

O54824

Predicted Effect

probably damaging
Transcript: ENSMUST00000001792
AA Change: E1273G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: E1273G

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075418

SMART Domains

Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
START	7	210	8.57e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000145610
AA Change: E575G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4563

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap5m1	A	G	14: 49,311,140 (GRCm39)	E70G	probably damaging	Het
Atp8b3	T	C	10: 80,372,181 (GRCm39)	E16G	probably benign	Het
Csmd3	A	T	15: 47,710,648 (GRCm39)	D1646E	probably damaging	Het
Cyp2c70	G	T	19: 40,172,468 (GRCm39)	A58E	probably damaging	Het
Ddx11	T	C	17: 66,446,434 (GRCm39)	I415T	possibly damaging	Het
Gm8674	T	A	13: 50,055,792 (GRCm39)		noncoding transcript	Het
H2-T22	A	C	17: 36,352,472 (GRCm39)	L151R	probably damaging	Het
Hmgcs1	C	A	13: 120,166,668 (GRCm39)	P420Q	probably damaging	Het
Ism2	T	C	12: 87,333,871 (GRCm39)	N58S	probably benign	Het
Kat7	T	C	11: 95,193,991 (GRCm39)	E103G	probably damaging	Het
Klf15	T	C	6: 90,443,802 (GRCm39)	S126P	probably benign	Het
Mapt	C	T	11: 104,189,548 (GRCm39)	R189*	probably null	Het
Meltf	C	T	16: 31,715,343 (GRCm39)	R679*	probably null	Het
Myo1d	T	C	11: 80,492,464 (GRCm39)	T764A	probably benign	Het
Mypn	T	C	10: 62,954,196 (GRCm39)		probably benign	Het
Or5b101	G	C	19: 13,005,411 (GRCm39)	A94G	probably benign	Het
Or8h8	C	T	2: 86,752,950 (GRCm39)	E309K	probably benign	Het
Ptpn4	T	C	1: 119,635,560 (GRCm39)	D381G	probably benign	Het
Ros1	C	A	10: 52,004,512 (GRCm39)		probably null	Het
Scel	T	G	14: 103,845,542 (GRCm39)	V559G	possibly damaging	Het
Sez6l	T	C	5: 112,574,615 (GRCm39)	D875G	probably damaging	Het
Slc18b1	T	G	10: 23,698,874 (GRCm39)	M348R	probably damaging	Het
Slc36a3	G	T	11: 55,033,607 (GRCm39)	T137K	probably benign	Het
Slco4c1	A	T	1: 96,768,976 (GRCm39)	S295R	probably benign	Het
Tmem181a	T	A	17: 6,346,061 (GRCm39)	L185H	probably damaging	Het
Tmprss15	A	T	16: 78,800,321 (GRCm39)	N587K	possibly damaging	Het
Upp1	T	C	11: 9,075,700 (GRCm39)		probably null	Het
Zp1	G	A	19: 10,895,956 (GRCm39)	R227W	probably benign	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83,301,666 (GRCm39)	missense	probably benign	0.02
IGL01743:Il16	APN	7	83,301,507 (GRCm39)	missense	probably benign	0.00
IGL01770:Il16	APN	7	83,322,234 (GRCm39)	splice site	probably benign
IGL02025:Il16	APN	7	83,302,056 (GRCm39)	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83,316,097 (GRCm39)	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83,301,899 (GRCm39)	missense	probably benign	0.03
IGL02550:Il16	APN	7	83,323,704 (GRCm39)	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83,310,484 (GRCm39)	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83,327,194 (GRCm39)	critical splice donor site	probably null
IGL02815:Il16	APN	7	83,300,249 (GRCm39)	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83,371,611 (GRCm39)	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83,371,707 (GRCm39)	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83,337,371 (GRCm39)	missense	probably benign	0.00
IGL03213:Il16	APN	7	83,295,708 (GRCm39)	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83,310,442 (GRCm39)	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83,371,516 (GRCm39)	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83,371,762 (GRCm39)	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83,327,183 (GRCm39)	splice site	probably benign
R0942:Il16	UTSW	7	83,312,349 (GRCm39)	missense	probably benign	0.01
R1018:Il16	UTSW	7	83,323,746 (GRCm39)	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83,304,520 (GRCm39)	missense	probably benign
R1715:Il16	UTSW	7	83,297,936 (GRCm39)	missense	probably benign	0.01
R2179:Il16	UTSW	7	83,337,287 (GRCm39)	splice site	probably null
R2520:Il16	UTSW	7	83,301,202 (GRCm39)	missense	probably benign	0.03
R3761:Il16	UTSW	7	83,300,093 (GRCm39)	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83,301,223 (GRCm39)	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83,300,046 (GRCm39)	intron	probably benign
R4530:Il16	UTSW	7	83,330,518 (GRCm39)	intron	probably benign
R4583:Il16	UTSW	7	83,332,107 (GRCm39)	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83,300,104 (GRCm39)	missense	probably benign	0.14
R4874:Il16	UTSW	7	83,310,153 (GRCm39)	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83,322,302 (GRCm39)	missense	probably benign
R5677:Il16	UTSW	7	83,323,761 (GRCm39)	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83,297,936 (GRCm39)	missense	probably benign	0.36
R5920:Il16	UTSW	7	83,301,552 (GRCm39)	missense	probably benign	0.03
R6115:Il16	UTSW	7	83,301,775 (GRCm39)	nonsense	probably null
R6459:Il16	UTSW	7	83,371,536 (GRCm39)	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83,371,529 (GRCm39)	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83,371,677 (GRCm39)	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83,295,684 (GRCm39)	missense	probably benign	0.37
R6642:Il16	UTSW	7	83,337,335 (GRCm39)	missense	probably benign	0.03
R6721:Il16	UTSW	7	83,312,270 (GRCm39)	critical splice donor site	probably null
R7009:Il16	UTSW	7	83,295,596 (GRCm39)	missense	probably benign
R7144:Il16	UTSW	7	83,295,659 (GRCm39)	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83,293,249 (GRCm39)	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83,319,343 (GRCm39)	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83,323,702 (GRCm39)	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83,319,348 (GRCm39)	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83,332,037 (GRCm39)	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83,295,767 (GRCm39)	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83,304,538 (GRCm39)	missense	probably benign
R8437:Il16	UTSW	7	83,301,351 (GRCm39)	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83,301,559 (GRCm39)	missense	probably benign
R9267:Il16	UTSW	7	83,371,757 (GRCm39)	missense	probably benign	0.01
R9445:Il16	UTSW	7	83,337,380 (GRCm39)	nonsense	probably null
R9595:Il16	UTSW	7	83,322,273 (GRCm39)	nonsense	probably null
R9651:Il16	UTSW	7	83,332,064 (GRCm39)	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83,302,035 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTGTCTTAGCATTGGCCGCC -3'
(R):5'- CCAGAGAGATGTTCCTGGTG -3'

Sequencing Primer
(F):5'- CTGCCTATGAGTCTGCAGAAG -3'
(R):5'- GTGTTACCATCCTGTGAAATGC -3'

Posted On

2015-03-25