Mutagenetix > Incidental Mutation

Incidental Mutation 'R3425:Il16'

271722

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

040643-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R3425 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83644040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 575 (E575G)

Ref Sequence

ENSEMBL: ENSMUSP00000146496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000075418] [ENSMUST00000117410] [ENSMUST00000145610]

AlphaFold

O54824

Predicted Effect

probably damaging
Transcript: ENSMUST00000001792
AA Change: E1273G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: E1273G

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075418

SMART Domains

Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
START	7	210	8.57e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000145610
AA Change: E575G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4563

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap5m1	A	G	14: 49,073,683	E70G	probably damaging	Het
Atp8b3	T	C	10: 80,536,347	E16G	probably benign	Het
Csmd3	A	T	15: 47,847,252	D1646E	probably damaging	Het
Cyp2c70	G	T	19: 40,184,024	A58E	probably damaging	Het
Ddx11	T	C	17: 66,139,439	I415T	possibly damaging	Het
Gm8674	T	A	13: 49,901,756		noncoding transcript	Het
H2-T22	A	C	17: 36,041,580	L151R	probably damaging	Het
Hmgcs1	C	A	13: 119,705,132	P420Q	probably damaging	Het
Ism2	T	C	12: 87,287,097	N58S	probably benign	Het
Kat7	T	C	11: 95,303,165	E103G	probably damaging	Het
Klf15	T	C	6: 90,466,820	S126P	probably benign	Het
Mapt	C	T	11: 104,298,722	R189*	probably null	Het
Meltf	C	T	16: 31,896,525	R679*	probably null	Het
Myo1d	T	C	11: 80,601,638	T764A	probably benign	Het
Mypn	T	C	10: 63,118,417		probably benign	Het
Olfr1098	C	T	2: 86,922,606	E309K	probably benign	Het
Olfr1453	G	C	19: 13,028,047	A94G	probably benign	Het
Ptpn4	T	C	1: 119,707,830	D381G	probably benign	Het
Ros1	C	A	10: 52,128,416		probably null	Het
Scel	T	G	14: 103,608,106	V559G	possibly damaging	Het
Sez6l	T	C	5: 112,426,749	D875G	probably damaging	Het
Slc18b1	T	G	10: 23,822,976	M348R	probably damaging	Het
Slc36a3	G	T	11: 55,142,781	T137K	probably benign	Het
Slco4c1	A	T	1: 96,841,251	S295R	probably benign	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmprss15	A	T	16: 79,003,433	N587K	possibly damaging	Het
Upp1	T	C	11: 9,125,700		probably null	Het
Zp1	G	A	19: 10,918,592	R227W	probably benign	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
R9651:Il16	UTSW	7	83682856	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTGTCTTAGCATTGGCCGCC -3'
(R):5'- CCAGAGAGATGTTCCTGGTG -3'

Sequencing Primer
(F):5'- CTGCCTATGAGTCTGCAGAAG -3'
(R):5'- GTGTTACCATCCTGTGAAATGC -3'

Posted On

2015-03-25