Incidental Mutation 'R3425:Slc18b1'
ID271724
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Namesolute carrier family 18, subfamily B, member 1
Synonyms1110021L09Rik
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23796986-23827968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23822976 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 348 (M348R)
Ref Sequence ENSEMBL: ENSMUSP00000112634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000179321]
Predicted Effect probably damaging
Transcript: ENSMUST00000119597
AA Change: M348R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: M348R

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143931
Predicted Effect probably damaging
Transcript: ENSMUST00000179321
AA Change: M350R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: M350R

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Meta Mutation Damage Score 0.7218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23824761 critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23803850 missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23826001 missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23810952 splice site probably benign
IGL03049:Slc18b1 APN 10 23822946 missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23826659 makesense probably null
R0440:Slc18b1 UTSW 10 23819078 missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23806038 missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23803795 missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23798741 splice site probably benign
R1842:Slc18b1 UTSW 10 23805993 missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23810922 missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3765:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23805981 missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23820869 missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23798766 missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23824667 intron probably benign
R6084:Slc18b1 UTSW 10 23804212 missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23816329 missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23804234 missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23826044 splice site probably null
R7632:Slc18b1 UTSW 10 23826182 missense probably benign
R8101:Slc18b1 UTSW 10 23822943 missense probably damaging 1.00
R8838:Slc18b1 UTSW 10 23820866 missense probably benign 0.25
R8868:Slc18b1 UTSW 10 23810853 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCGCCTCATATTTAAGTTTGTG -3'
(R):5'- TGCTATCACAGGATGATCTCG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CTATCACAGGATGATCTCGTTATTAC -3'
Posted On2015-03-25