Incidental Mutation 'R3425:Upp1'
ID271728
Institutional Source Beutler Lab
Gene Symbol Upp1
Ensembl Gene ENSMUSG00000020407
Gene Nameuridine phosphorylase 1
SynonymsUPase, UdRPase, Up
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9118103-9136170 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 9125700 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020677] [ENSMUST00000101525] [ENSMUST00000130522] [ENSMUST00000164791] [ENSMUST00000170444] [ENSMUST00000172452]
Predicted Effect probably null
Transcript: ENSMUST00000020677
SMART Domains Protein: ENSMUSP00000020677
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101525
SMART Domains Protein: ENSMUSP00000099063
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130522
SMART Domains Protein: ENSMUSP00000123285
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
PDB:3NBQ|D 1 137 9e-76 PDB
SCOP:d1k9sa_ 43 127 1e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164791
SMART Domains Protein: ENSMUSP00000127473
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166455
SMART Domains Protein: ENSMUSP00000129276
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 45 143 6.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170444
SMART Domains Protein: ENSMUSP00000125934
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 149 3.9e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172452
SMART Domains Protein: ENSMUSP00000129787
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
PDB:3NBQ|D 1 114 4e-60 PDB
SCOP:d1lx7a_ 35 114 7e-10 SMART
Meta Mutation Damage Score 0.9460 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a targeted disruption have increased uridine concentration in tissues, urine and blood, along with disorders of various nucleotide metabolisms and decreased sensitivity to pentobarbital and 5-fluorouracil. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Upp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Upp1 APN 11 9136100 makesense probably null
IGL01870:Upp1 APN 11 9125700 critical splice donor site probably null
IGL02125:Upp1 APN 11 9125650 utr 5 prime probably benign
R0373:Upp1 UTSW 11 9129590 missense probably benign 0.01
R1501:Upp1 UTSW 11 9134708 splice site probably null
R1617:Upp1 UTSW 11 9134865 missense probably damaging 0.99
R1980:Upp1 UTSW 11 9134872 missense possibly damaging 0.67
R2018:Upp1 UTSW 11 9133240 missense possibly damaging 0.94
R2019:Upp1 UTSW 11 9133240 missense possibly damaging 0.94
R2214:Upp1 UTSW 11 9136033 missense probably benign
R4063:Upp1 UTSW 11 9131709 missense probably damaging 1.00
R4247:Upp1 UTSW 11 9134815 missense probably benign
R4776:Upp1 UTSW 11 9135976 missense probably damaging 0.98
R5160:Upp1 UTSW 11 9135193 missense possibly damaging 0.68
R5500:Upp1 UTSW 11 9131774 missense probably damaging 1.00
R5514:Upp1 UTSW 11 9131771 missense probably damaging 1.00
R5677:Upp1 UTSW 11 9136025 missense probably benign
R6825:Upp1 UTSW 11 9131707 missense probably benign
R7325:Upp1 UTSW 11 9134743 missense probably damaging 0.98
R8749:Upp1 UTSW 11 9129561 missense probably damaging 1.00
X0022:Upp1 UTSW 11 9125681 missense probably benign 0.00
X0022:Upp1 UTSW 11 9125682 missense possibly damaging 0.53
X0027:Upp1 UTSW 11 9134857 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTGTGGCGTCTACCCTTG -3'
(R):5'- AAGGACCAAAGCTCCTGGAC -3'

Sequencing Primer
(F):5'- CGAGCGAGCATGTGTACATTTCC -3'
(R):5'- CAAAGCTCCTGGACCTGAATTTG -3'
Posted On2015-03-25