Incidental Mutation 'R3425:Slc36a3'
ID271729
Institutional Source Beutler Lab
Gene Symbol Slc36a3
Ensembl Gene ENSMUSG00000049491
Gene Namesolute carrier family 36 (proton/amino acid symporter), member 3
SynonymsTRAMD2, tramdorin2, PAT3
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55124815-55151708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55142781 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 137 (T137K)
Ref Sequence ENSEMBL: ENSMUSP00000020502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020502] [ENSMUST00000128244]
Predicted Effect probably benign
Transcript: ENSMUST00000020502
AA Change: T137K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020502
Gene: ENSMUSG00000049491
AA Change: T137K

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 459 7.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128244
SMART Domains Protein: ENSMUSP00000116073
Gene: ENSMUSG00000049491

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 87 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155883
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Slc36a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03104:Slc36a3 APN 11 55125120 missense probably damaging 1.00
IGL03241:Slc36a3 APN 11 55125108 missense possibly damaging 0.95
R0632:Slc36a3 UTSW 11 55125080 missense probably damaging 1.00
R1117:Slc36a3 UTSW 11 55146180 missense possibly damaging 0.78
R1549:Slc36a3 UTSW 11 55142770 missense probably damaging 1.00
R3423:Slc36a3 UTSW 11 55142781 missense probably benign 0.00
R3791:Slc36a3 UTSW 11 55125156 missense possibly damaging 0.95
R3980:Slc36a3 UTSW 11 55135383 missense probably benign
R4970:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R4973:Slc36a3 UTSW 11 55146804 splice site probably benign
R4986:Slc36a3 UTSW 11 55146766 makesense probably null
R5112:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R5399:Slc36a3 UTSW 11 55146180 missense possibly damaging 0.78
R5534:Slc36a3 UTSW 11 55142769 missense possibly damaging 0.83
R5580:Slc36a3 UTSW 11 55135453 missense probably benign 0.14
R5682:Slc36a3 UTSW 11 55125663 missense probably benign 0.00
R5779:Slc36a3 UTSW 11 55135268 nonsense probably null
R5841:Slc36a3 UTSW 11 55125721 nonsense probably null
R6228:Slc36a3 UTSW 11 55124951 missense probably benign 0.01
R6483:Slc36a3 UTSW 11 55135263 missense probably benign 0.01
R6908:Slc36a3 UTSW 11 55149886 intron probably benign
R6927:Slc36a3 UTSW 11 55129693 missense probably damaging 0.98
R7828:Slc36a3 UTSW 11 55151198 missense probably benign 0.00
R7995:Slc36a3 UTSW 11 55129669 missense probably benign 0.04
R8212:Slc36a3 UTSW 11 55125081 missense probably damaging 1.00
R8238:Slc36a3 UTSW 11 55131607 missense probably benign 0.05
R8239:Slc36a3 UTSW 11 55131607 missense probably benign 0.05
R8329:Slc36a3 UTSW 11 55148583 missense probably damaging 1.00
R8929:Slc36a3 UTSW 11 55137311 missense probably damaging 1.00
Z1177:Slc36a3 UTSW 11 55135452 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGGGAGATACTCTATCTTGC -3'
(R):5'- GGTGTCCTTATTAGAGAGTGCAC -3'

Sequencing Primer
(F):5'- CCTAGCGGAACTTGCAGTCATATG -3'
(R):5'- GTCCTTATTAGAGAGTGCACAGAAC -3'
Posted On2015-03-25