Mutagenetix > Incidental Mutation

Incidental Mutation 'R3425:Myo1d'

271730

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

040643-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3425 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80601638 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 764 (T764A)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

probably benign
Transcript: ENSMUST00000041065
AA Change: T764A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: T764A

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000070997
AA Change: T764A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: T764A

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

97% (30/31)

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap5m1	A	G	14: 49,073,683	E70G	probably damaging	Het
Atp8b3	T	C	10: 80,536,347	E16G	probably benign	Het
Csmd3	A	T	15: 47,847,252	D1646E	probably damaging	Het
Cyp2c70	G	T	19: 40,184,024	A58E	probably damaging	Het
Ddx11	T	C	17: 66,139,439	I415T	possibly damaging	Het
Gm8674	T	A	13: 49,901,756		noncoding transcript	Het
H2-T22	A	C	17: 36,041,580	L151R	probably damaging	Het
Hmgcs1	C	A	13: 119,705,132	P420Q	probably damaging	Het
Il16	T	C	7: 83,644,040	E575G	probably damaging	Het
Ism2	T	C	12: 87,287,097	N58S	probably benign	Het
Kat7	T	C	11: 95,303,165	E103G	probably damaging	Het
Klf15	T	C	6: 90,466,820	S126P	probably benign	Het
Mapt	C	T	11: 104,298,722	R189*	probably null	Het
Meltf	C	T	16: 31,896,525	R679*	probably null	Het
Mypn	T	C	10: 63,118,417		probably benign	Het
Olfr1098	C	T	2: 86,922,606	E309K	probably benign	Het
Olfr1453	G	C	19: 13,028,047	A94G	probably benign	Het
Ptpn4	T	C	1: 119,707,830	D381G	probably benign	Het
Ros1	C	A	10: 52,128,416		probably null	Het
Scel	T	G	14: 103,608,106	V559G	possibly damaging	Het
Sez6l	T	C	5: 112,426,749	D875G	probably damaging	Het
Slc18b1	T	G	10: 23,822,976	M348R	probably damaging	Het
Slc36a3	G	T	11: 55,142,781	T137K	probably benign	Het
Slco4c1	A	T	1: 96,841,251	S295R	probably benign	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmprss15	A	T	16: 79,003,433	N587K	possibly damaging	Het
Upp1	T	C	11: 9,125,700		probably null	Het
Zp1	G	A	19: 10,918,592	R227W	probably benign	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCGATCAAACTCAAGGCAGAGG -3'
(R):5'- CACTACTACTTAGTCAGCCAGC -3'

Sequencing Primer
(F):5'- GGAGAGGCAGGCGTCATAAC -3'
(R):5'- GTCAGCCAGCAATGTTTTCAG -3'

Posted On

2015-03-25