Incidental Mutation 'R3425:Ism2'
ID271733
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87287097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 58 (N58S)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
Predicted Effect probably benign
Transcript: ENSMUST00000051601
AA Change: N14S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: N14S

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125733
AA Change: N58S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: N58S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145714
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
canal UTSW 12 87280061 missense probably damaging 1.00
panamin UTSW 12 87286884 splice site probably null
Zone UTSW 12 87299663 missense unknown
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
R7973:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCTGTGTTGGCCAACC -3'
(R):5'- TCACTAGAGCCCTATGTGGC -3'

Sequencing Primer
(F):5'- AACCCTGGTAGCTTCTGCAG -3'
(R):5'- AGTGAACACAGTCCATTTTTCTCTG -3'
Posted On2015-03-25