Incidental Mutation 'R3425:Gm8674'
ID271734
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Namepredicted gene 8674
Synonyms
MMRRC Submission 040643-MU
Accession Numbers

Genbank: XM_990959; MGI: 3645762

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49899119-49904597 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 49901756 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 49901939 exon noncoding transcript
R0357:Gm8674 UTSW 13 49902113 exon noncoding transcript
R0627:Gm8674 UTSW 13 49899715 exon noncoding transcript
R0833:Gm8674 UTSW 13 49904575 exon noncoding transcript
R1300:Gm8674 UTSW 13 49901722 exon noncoding transcript
R1452:Gm8674 UTSW 13 49900517 exon noncoding transcript
R1542:Gm8674 UTSW 13 49900003 exon noncoding transcript
R1613:Gm8674 UTSW 13 49902438 intron noncoding transcript
R1643:Gm8674 UTSW 13 49901358 exon noncoding transcript
R1732:Gm8674 UTSW 13 49901926 exon noncoding transcript
R1824:Gm8674 UTSW 13 49900808 exon noncoding transcript
R1840:Gm8674 UTSW 13 49901765 exon noncoding transcript
R1915:Gm8674 UTSW 13 49900853 exon noncoding transcript
R1934:Gm8674 UTSW 13 49901435 exon noncoding transcript
R2040:Gm8674 UTSW 13 49901669 exon noncoding transcript
R2214:Gm8674 UTSW 13 49901360 exon noncoding transcript
R2421:Gm8674 UTSW 13 49900663 exon noncoding transcript
R3423:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3886:Gm8674 UTSW 13 49902163 splice site noncoding transcript
R4083:Gm8674 UTSW 13 49901011 exon noncoding transcript
R4343:Gm8674 UTSW 13 49899706 exon noncoding transcript
R4570:Gm8674 UTSW 13 49902534 intron noncoding transcript
R4936:Gm8674 UTSW 13 49900755 exon noncoding transcript
R4967:Gm8674 UTSW 13 49901998 exon noncoding transcript
R5065:Gm8674 UTSW 13 49902577 intron noncoding transcript
R5067:Gm8674 UTSW 13 49899834 exon noncoding transcript
R5120:Gm8674 UTSW 13 49901948 exon noncoding transcript
R5208:Gm8674 UTSW 13 49901921 exon noncoding transcript
R5268:Gm8674 UTSW 13 49901354 exon noncoding transcript
R5471:Gm8674 UTSW 13 49900813 exon noncoding transcript
R5773:Gm8674 UTSW 13 49901876 exon noncoding transcript
R5809:Gm8674 UTSW 13 49901888 exon noncoding transcript
R8162:Gm8674 UTSW 13 49900371 missense noncoding transcript
R8239:Gm8674 UTSW 13 49900226 missense noncoding transcript
Z1088:Gm8674 UTSW 13 49900794 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49901248 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAGGAATCTGCTGGGAGTTC -3'
(R):5'- TGTGACACAATGCCTGGAAAATG -3'

Sequencing Primer
(F):5'- AATCTGCTGGGAGTTCCTTGC -3'
(R):5'- CCTGGAAAATGAGACATGGTTCC -3'
Posted On2015-03-25