Incidental Mutation 'R3425:Hmgcs1'
ID271735
Institutional Source Beutler Lab
Gene Symbol Hmgcs1
Ensembl Gene ENSMUSG00000093930
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1
SynonymsB130032C06Rik
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119690379-119708260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119705132 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 420 (P420Q)
Ref Sequence ENSEMBL: ENSMUSP00000153064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178142] [ENSMUST00000179869] [ENSMUST00000224188]
Predicted Effect probably benign
Transcript: ENSMUST00000178142
SMART Domains Protein: ENSMUSP00000136377
Gene: ENSMUSG00000095930

DomainStartEndE-ValueType
S_TKc 74 325 8.66e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179869
AA Change: P420Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136944
Gene: ENSMUSG00000093930
AA Change: P420Q

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 13 186 4e-111 PFAM
Pfam:HMG_CoA_synt_C 187 469 4e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223791
Predicted Effect probably damaging
Transcript: ENSMUST00000224188
AA Change: P420Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226092
Meta Mutation Damage Score 0.8880 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Hmgcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Hmgcs1 UTSW 13 119699963 missense possibly damaging 0.62
BB017:Hmgcs1 UTSW 13 119699963 missense possibly damaging 0.62
R1521:Hmgcs1 UTSW 13 119703591 missense probably benign 0.01
R3156:Hmgcs1 UTSW 13 119705078 missense probably benign
R5084:Hmgcs1 UTSW 13 119699984 missense possibly damaging 0.82
R5560:Hmgcs1 UTSW 13 119699815 splice site probably null
R6052:Hmgcs1 UTSW 13 119705459 missense probably benign
R6746:Hmgcs1 UTSW 13 119695049 critical splice donor site probably null
R6845:Hmgcs1 UTSW 13 119701138 missense probably damaging 0.96
R6861:Hmgcs1 UTSW 13 119699999 missense probably damaging 1.00
R7208:Hmgcs1 UTSW 13 119701084 missense probably damaging 1.00
R7930:Hmgcs1 UTSW 13 119699963 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGTAGGCAGCTGTCTCAAGAC -3'
(R):5'- TGGCAATCCAACTAGACAGG -3'

Sequencing Primer
(F):5'- AAGTTTCTTTGAGAGGTGC -3'
(R):5'- GGATTTTCACTGACATCACACTAGC -3'
Posted On2015-03-25