Incidental Mutation 'R3425:Ap5m1'
ID271736
Institutional Source Beutler Lab
Gene Symbol Ap5m1
Ensembl Gene ENSMUSG00000036291
Gene Nameadaptor-related protein complex 5, mu 1 subunit
SynonymsMudeng, 4932432K03Rik
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49066097-49094234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49073683 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 70 (E70G)
Ref Sequence ENSEMBL: ENSMUSP00000153761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037473] [ENSMUST00000227410] [ENSMUST00000227431] [ENSMUST00000227608] [ENSMUST00000228238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037473
AA Change: E70G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046536
Gene: ENSMUSG00000036291
AA Change: E70G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
Pfam:Adap_comp_sub 196 476 3.2e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227410
AA Change: E70G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227431
AA Change: E70G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227608
AA Change: E70G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000227991
Predicted Effect possibly damaging
Transcript: ENSMUST00000228238
AA Change: E70G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Ap5m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Ap5m1 APN 14 49073790 missense probably damaging 1.00
IGL01806:Ap5m1 APN 14 49080340 missense probably damaging 1.00
IGL02011:Ap5m1 APN 14 49081135 unclassified probably benign
IGL02165:Ap5m1 APN 14 49078728 missense possibly damaging 0.94
IGL02203:Ap5m1 APN 14 49080258 missense probably damaging 1.00
IGL02950:Ap5m1 APN 14 49073935 missense probably benign 0.44
IGL03123:Ap5m1 APN 14 49073761 missense probably damaging 1.00
IGL03368:Ap5m1 APN 14 49081136 unclassified probably benign
R1688:Ap5m1 UTSW 14 49080834 critical splice acceptor site probably null
R2113:Ap5m1 UTSW 14 49086248 missense probably damaging 1.00
R2184:Ap5m1 UTSW 14 49086295 missense probably damaging 1.00
R2220:Ap5m1 UTSW 14 49081095 missense probably damaging 1.00
R2971:Ap5m1 UTSW 14 49083882 nonsense probably null
R4506:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R4679:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R4799:Ap5m1 UTSW 14 49081070 missense probably benign 0.08
R6365:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R6834:Ap5m1 UTSW 14 49073737 missense probably damaging 0.99
R7115:Ap5m1 UTSW 14 49086270 nonsense probably null
R7224:Ap5m1 UTSW 14 49080927 missense unknown
R7383:Ap5m1 UTSW 14 49074196 missense possibly damaging 0.77
R7539:Ap5m1 UTSW 14 49073557 missense probably damaging 1.00
R7866:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7897:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
R7949:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7980:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATGCCTTACTGTCATGACTGTTTG -3'
(R):5'- GTTCCAAGCCTTGTGAGACC -3'

Sequencing Primer
(F):5'- CTTACTGTCATGACTGTTTGACTTG -3'
(R):5'- CCCACTAATGCTAATTAAAGGTGGGC -3'
Posted On2015-03-25