Incidental Mutation 'R3425:H2-T22'
ID271742
Institutional Source Beutler Lab
Gene Symbol H2-T22
Ensembl Gene ENSMUSG00000056116
Gene Namehistocompatibility 2, T region locus 22
SynonymsH-2T22, H-2T17, H2-T17
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36037128-36042747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36041580 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 151 (L151R)
Ref Sequence ENSEMBL: ENSMUSP00000078927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058801] [ENSMUST00000077960] [ENSMUST00000080015] [ENSMUST00000097331] [ENSMUST00000173280]
Predicted Effect probably damaging
Transcript: ENSMUST00000058801
AA Change: L151R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056041
Gene: ENSMUSG00000056116
AA Change: L151R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 5.8e-47 PFAM
IGc1 210 281 2.06e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077960
AA Change: L151R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077111
Gene: ENSMUSG00000056116
AA Change: L151R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 4e-47 PFAM
IGc1 210 281 2.06e-23 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080015
AA Change: L151R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078927
Gene: ENSMUSG00000056116
AA Change: L151R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 7.3e-47 PFAM
IGc1 210 281 2.06e-23 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097331
SMART Domains Protein: ENSMUSP00000094943
Gene: ENSMUSG00000073407

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172633
Predicted Effect probably benign
Transcript: ENSMUST00000173280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Meta Mutation Damage Score 0.6634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in H2-T22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:H2-T22 APN 17 36041919 missense probably damaging 0.99
IGL02978:H2-T22 APN 17 36041625 missense probably benign 0.00
R0078:H2-T22 UTSW 17 36040609 missense probably damaging 0.99
R0448:H2-T22 UTSW 17 36042386 missense possibly damaging 0.96
R1402:H2-T22 UTSW 17 36040269 missense possibly damaging 0.95
R1402:H2-T22 UTSW 17 36040269 missense possibly damaging 0.95
R1592:H2-T22 UTSW 17 36041577 missense probably damaging 0.99
R1830:H2-T22 UTSW 17 36041542 missense probably benign 0.00
R2105:H2-T22 UTSW 17 36040517 missense probably benign 0.23
R2116:H2-T22 UTSW 17 36039057 splice site probably null
R2964:H2-T22 UTSW 17 36040645 missense probably damaging 1.00
R2965:H2-T22 UTSW 17 36040645 missense probably damaging 1.00
R3875:H2-T22 UTSW 17 36040303 missense probably benign 0.03
R4614:H2-T22 UTSW 17 36040537 missense probably benign 0.28
R4691:H2-T22 UTSW 17 36041570 frame shift probably null
R4870:H2-T22 UTSW 17 36039032 missense probably benign 0.00
R4954:H2-T22 UTSW 17 36041959 missense probably damaging 1.00
R5109:H2-T22 UTSW 17 36039221 nonsense probably null
R5995:H2-T22 UTSW 17 36041485 missense probably benign 0.18
R7379:H2-T22 UTSW 17 36042340 critical splice donor site probably null
R7597:H2-T22 UTSW 17 36040516 missense probably damaging 1.00
R8719:H2-T22 UTSW 17 36041943 missense probably benign 0.04
R8861:H2-T22 UTSW 17 36042398 missense possibly damaging 0.86
Z1088:H2-T22 UTSW 17 36041638 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAGCTGTACTCCAAGTCCTC -3'
(R):5'- CCAAGAGTCTGCAGGGATTTAC -3'

Sequencing Primer
(F):5'- GAGCTGTACTCCAAGTCCTCTCTTC -3'
(R):5'- AAGAGTCTGCAGGGATTTACTTGGAG -3'
Posted On2015-03-25