Incidental Mutation 'R3425:Zp1'
ID271745
Institutional Source Beutler Lab
Gene Symbol Zp1
Ensembl Gene ENSMUSG00000024734
Gene Namezona pellucida glycoprotein 1
Synonyms
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10914287-10920632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10918592 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 227 (R227W)
Ref Sequence ENSEMBL: ENSMUSP00000025641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]
Predicted Effect probably benign
Transcript: ENSMUST00000025641
AA Change: R227W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: R227W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
PD 226 269 2.33e-11 SMART
ZP 271 542 1.55e-102 SMART
low complexity region 580 589 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168708
SMART Domains Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 61 5.6e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Other mutations in Zp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zp1 APN 19 10918777 missense probably damaging 1.00
IGL01504:Zp1 APN 19 10919011 missense probably damaging 0.99
IGL02260:Zp1 APN 19 10916714 unclassified probably benign
IGL02465:Zp1 APN 19 10920487 missense probably benign 0.09
IGL02634:Zp1 APN 19 10919507 unclassified probably benign
IGL02714:Zp1 APN 19 10918612 missense probably damaging 1.00
IGL03234:Zp1 APN 19 10914823 splice site probably benign
IGL03404:Zp1 APN 19 10914461 unclassified probably benign
R0504:Zp1 UTSW 19 10916207 missense probably damaging 0.98
R0554:Zp1 UTSW 19 10920562 missense probably benign 0.29
R1028:Zp1 UTSW 19 10918911 missense probably benign 0.01
R1279:Zp1 UTSW 19 10918577 missense probably damaging 1.00
R1460:Zp1 UTSW 19 10918878 missense probably benign
R3832:Zp1 UTSW 19 10916524 missense probably damaging 1.00
R4420:Zp1 UTSW 19 10914760 splice site probably null
R4669:Zp1 UTSW 19 10918905 missense probably benign 0.31
R4849:Zp1 UTSW 19 10918834 missense possibly damaging 0.90
R5134:Zp1 UTSW 19 10920562 missense probably benign 0.29
R5170:Zp1 UTSW 19 10920554 missense possibly damaging 0.56
R5510:Zp1 UTSW 19 10919405 missense probably damaging 1.00
R6284:Zp1 UTSW 19 10916503 missense probably damaging 1.00
R6307:Zp1 UTSW 19 10916720 missense probably null 0.45
R6378:Zp1 UTSW 19 10914853 missense probably benign 0.15
R6608:Zp1 UTSW 19 10918980 missense possibly damaging 0.93
R6697:Zp1 UTSW 19 10914835 missense probably benign 0.05
R6862:Zp1 UTSW 19 10916513 missense possibly damaging 0.84
R7054:Zp1 UTSW 19 10918740 missense probably damaging 0.98
R7253:Zp1 UTSW 19 10916569 missense probably damaging 0.99
R7483:Zp1 UTSW 19 10917916 missense possibly damaging 0.72
R7591:Zp1 UTSW 19 10919471 missense probably damaging 1.00
R8857:Zp1 UTSW 19 10916524 missense probably damaging 1.00
Z1176:Zp1 UTSW 19 10917914 missense probably damaging 1.00
Z1177:Zp1 UTSW 19 10918604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCTCTTAGGCTGCATACAAG -3'
(R):5'- TGCTGGATCCACTGTACCTC -3'

Sequencing Primer
(F):5'- TGCATACAAGGCAGTTCAGC -3'
(R):5'- ACTGTACCTCACTCCCAATGGG -3'
Posted On2015-03-25