Incidental Mutation 'R3425:Olfr1453'
ID271746
Institutional Source Beutler Lab
Gene Symbol Olfr1453
Ensembl Gene ENSMUSG00000094755
Gene Nameolfactory receptor 1453
SynonymsMOR202-6, GA_x6K02T2RE5P-3357666-3356743
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13027404-13028327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13028047 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 94 (A94G)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: A94G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: A94G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Olfr1453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Olfr1453 APN 19 13027591 missense probably damaging 0.98
IGL01137:Olfr1453 APN 19 13028030 missense possibly damaging 0.52
IGL01894:Olfr1453 APN 19 13028285 missense probably damaging 1.00
IGL02579:Olfr1453 APN 19 13027528 missense probably damaging 0.99
PIT4418001:Olfr1453 UTSW 19 13027731 nonsense probably null
R0099:Olfr1453 UTSW 19 13027801 missense probably damaging 1.00
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0395:Olfr1453 UTSW 19 13028299 missense probably damaging 1.00
R0453:Olfr1453 UTSW 19 13027931 missense probably damaging 0.97
R0847:Olfr1453 UTSW 19 13027731 nonsense probably null
R1227:Olfr1453 UTSW 19 13027853 missense probably benign
R1823:Olfr1453 UTSW 19 13027817 missense probably benign 0.06
R2509:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2899:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2964:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R2965:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R3157:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3158:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3409:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3410:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3411:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R4018:Olfr1453 UTSW 19 13027825 missense probably benign
R4668:Olfr1453 UTSW 19 13028081 missense probably benign 0.00
R4805:Olfr1453 UTSW 19 13028297 missense probably benign 0.04
R5180:Olfr1453 UTSW 19 13027412 missense probably benign 0.01
R5391:Olfr1453 UTSW 19 13027786 missense probably damaging 1.00
R5557:Olfr1453 UTSW 19 13027640 missense probably benign 0.01
R5740:Olfr1453 UTSW 19 13027562 missense probably benign 0.24
R7472:Olfr1453 UTSW 19 13028075 missense probably benign
R7832:Olfr1453 UTSW 19 13027996 missense probably benign 0.02
R7970:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R8044:Olfr1453 UTSW 19 13027465 missense probably damaging 1.00
R8229:Olfr1453 UTSW 19 13028197 missense possibly damaging 0.55
R8474:Olfr1453 UTSW 19 13027993 missense probably damaging 1.00
Z1088:Olfr1453 UTSW 19 13028027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACAGAAGGAGAGACTTAATGC -3'
(R):5'- CACCCTTATAGGAAATCTTGGGC -3'

Sequencing Primer
(F):5'- AGGAGAGACTTAATGCATCCATAG -3'
(R):5'- CCCTTATAGGAAATCTTGGGCTGATC -3'
Posted On2015-03-25