Incidental Mutation 'R3425:Cyp2c70'
ID271747
Institutional Source Beutler Lab
Gene Symbol Cyp2c70
Ensembl Gene ENSMUSG00000060613
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 70
Synonyms
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40153353-40187333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40184024 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 58 (A58E)
Ref Sequence ENSEMBL: ENSMUSP00000060584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051846] [ENSMUST00000165102] [ENSMUST00000171604]
Predicted Effect probably damaging
Transcript: ENSMUST00000051846
AA Change: A58E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060584
Gene: ENSMUSG00000060613
AA Change: A58E

DomainStartEndE-ValueType
Pfam:p450 30 486 2.1e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164351
Predicted Effect probably benign
Transcript: ENSMUST00000165102
SMART Domains Protein: ENSMUSP00000128691
Gene: ENSMUSG00000060613

DomainStartEndE-ValueType
PDB:4GQS|D 25 54 4e-12 PDB
SCOP:d1cpt__ 26 54 7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171604
SMART Domains Protein: ENSMUSP00000129063
Gene: ENSMUSG00000060613

DomainStartEndE-ValueType
PDB:4GQS|D 25 50 4e-10 PDB
SCOP:d1cpt__ 26 54 2e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Cyp2c70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c70 APN 19 40156826 missense probably benign 0.00
IGL00335:Cyp2c70 APN 19 40167576 missense probably damaging 1.00
IGL01966:Cyp2c70 APN 19 40153572 utr 3 prime probably benign
PIT4468001:Cyp2c70 UTSW 19 40165362 missense probably damaging 1.00
R0012:Cyp2c70 UTSW 19 40187243 missense probably null 1.00
R0044:Cyp2c70 UTSW 19 40165371 missense possibly damaging 0.85
R0309:Cyp2c70 UTSW 19 40160671 missense possibly damaging 0.94
R1572:Cyp2c70 UTSW 19 40183982 missense probably benign 0.21
R1650:Cyp2c70 UTSW 19 40165477 missense probably benign 0.00
R1671:Cyp2c70 UTSW 19 40153637 missense probably damaging 1.00
R2016:Cyp2c70 UTSW 19 40164412 missense possibly damaging 0.94
R2163:Cyp2c70 UTSW 19 40160719 missense possibly damaging 0.64
R4299:Cyp2c70 UTSW 19 40183928 missense probably benign 0.00
R5037:Cyp2c70 UTSW 19 40183997 missense possibly damaging 0.72
R5103:Cyp2c70 UTSW 19 40160632 missense probably damaging 0.96
R6060:Cyp2c70 UTSW 19 40165413 nonsense probably null
R6440:Cyp2c70 UTSW 19 40156806 missense possibly damaging 0.64
R6853:Cyp2c70 UTSW 19 40183920 missense possibly damaging 0.72
R6936:Cyp2c70 UTSW 19 40167563 missense probably damaging 0.97
R7098:Cyp2c70 UTSW 19 40180487 missense probably benign 0.02
R8380:Cyp2c70 UTSW 19 40187225 missense probably benign 0.03
R8419:Cyp2c70 UTSW 19 40160580 missense possibly damaging 0.57
R8555:Cyp2c70 UTSW 19 40183901 missense probably benign 0.04
R8678:Cyp2c70 UTSW 19 40167572 missense probably damaging 1.00
R8705:Cyp2c70 UTSW 19 40180504 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAAGGAGACGTACCTAAGCC -3'
(R):5'- CAGTGAATGGGTGAATATTAAAATGTC -3'

Sequencing Primer
(F):5'- AGACGTACCTAAGCCTTGGCTG -3'
(R):5'- GATATCAGGCTCCTGTCAGCAAG -3'
Posted On2015-03-25