Incidental Mutation 'R3706:Fam178b'
ID271748
Institutional Source Beutler Lab
Gene Symbol Fam178b
Ensembl Gene ENSMUSG00000046337
Gene Namefamily with sequence similarity 178, member B
Synonyms1700024G10Rik, LOC381337
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36562692-36683183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36608448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 235 (Y235H)
Ref Sequence ENSEMBL: ENSMUSP00000132846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114981] [ENSMUST00000170295]
Predicted Effect probably benign
Transcript: ENSMUST00000114981
AA Change: Y235H

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124023
Gene: ENSMUSG00000046337
AA Change: Y235H

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 89 371 3.4e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170295
AA Change: Y235H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132846
Gene: ENSMUSG00000046337
AA Change: Y235H

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 86 385 1e-130 PFAM
low complexity region 395 410 N/A INTRINSIC
Meta Mutation Damage Score 0.1862 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Fam178b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Fam178b APN 1 36564403 missense possibly damaging 0.90
IGL01128:Fam178b APN 1 36644354 missense probably damaging 1.00
IGL01859:Fam178b APN 1 36659365 missense probably damaging 1.00
R0398:Fam178b UTSW 1 36632406 splice site probably benign
R1116:Fam178b UTSW 1 36578588 nonsense probably null
R1613:Fam178b UTSW 1 36600192 missense probably benign 0.01
R1623:Fam178b UTSW 1 36644324 missense probably damaging 1.00
R2276:Fam178b UTSW 1 36632458 missense probably damaging 1.00
R4535:Fam178b UTSW 1 36600525 missense probably benign 0.43
R4784:Fam178b UTSW 1 36632415 splice site probably null
R5372:Fam178b UTSW 1 36564848 missense possibly damaging 0.95
R5431:Fam178b UTSW 1 36632485 missense probably damaging 1.00
R6808:Fam178b UTSW 1 36600135 missense probably damaging 1.00
R7117:Fam178b UTSW 1 36600467 missense probably benign 0.04
R7308:Fam178b UTSW 1 36659407 missense probably benign
R7573:Fam178b UTSW 1 36632452 missense probably damaging 1.00
R7678:Fam178b UTSW 1 36564451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTTGTCTAGGTACCTGAGC -3'
(R):5'- TTGCTTCATTTCTGCAGCGAG -3'

Sequencing Primer
(F):5'- TCTAGGTACCTGAGCTCTGGGC -3'
(R):5'- TCCTTGTGCAAGTACAGAGC -3'
Posted On2015-03-25