Incidental Mutation 'R3706:Cenpl'
ID271751
Institutional Source Beutler Lab
Gene Symbol Cenpl
Ensembl Gene ENSMUSG00000026708
Gene Namecentromere protein L
Synonyms2610300B10Rik
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161070713-161086724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 161078415 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 120 (V120M)
Ref Sequence ENSEMBL: ENSMUSP00000142254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028035] [ENSMUST00000111618] [ENSMUST00000111620] [ENSMUST00000143486] [ENSMUST00000192150] [ENSMUST00000192850] [ENSMUST00000194855] [ENSMUST00000195571]
Predicted Effect probably damaging
Transcript: ENSMUST00000028035
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028035
Gene: ENSMUSG00000026708
AA Change: V120M

DomainStartEndE-ValueType
Pfam:CENP-L 177 327 3.3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111618
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107245
Gene: ENSMUSG00000026708
AA Change: V120M

DomainStartEndE-ValueType
Pfam:CENP-L 177 327 5.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111620
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107247
Gene: ENSMUSG00000026708
AA Change: V120M

DomainStartEndE-ValueType
Pfam:CENP-L 178 325 1.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155808
Predicted Effect probably benign
Transcript: ENSMUST00000192150
Predicted Effect probably damaging
Transcript: ENSMUST00000192850
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000194855
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000195571
AA Change: V120M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPL is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006) [PubMed 16622420].[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Cenpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Cenpl APN 1 161083287 missense possibly damaging 0.94
IGL02479:Cenpl APN 1 161083067 missense probably benign 0.00
IGL02884:Cenpl APN 1 161086049 missense probably benign 0.37
R0193:Cenpl UTSW 1 161085988 missense probably damaging 0.99
R1847:Cenpl UTSW 1 161086004 missense probably damaging 0.99
R1995:Cenpl UTSW 1 161078424 missense probably damaging 1.00
R2986:Cenpl UTSW 1 161083467 unclassified probably benign
R4739:Cenpl UTSW 1 161083267 missense probably damaging 1.00
R5193:Cenpl UTSW 1 161083467 nonsense probably null
R6321:Cenpl UTSW 1 161074895 missense probably benign 0.00
R7145:Cenpl UTSW 1 161082912 missense possibly damaging 0.93
R7382:Cenpl UTSW 1 161078461 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAGAAGGTTGCATTTCTCCTC -3'
(R):5'- TGTGTGTTTTCTAAAATCAACACCAT -3'

Sequencing Primer
(F):5'- GAAGGTTGCATTTCTCCTCCACAAAC -3'
(R):5'- TTCTCCAAATTGCACAGGGG -3'
Posted On2015-03-25