Incidental Mutation 'R3706:Fpgs'
ID271753
Institutional Source Beutler Lab
Gene Symbol Fpgs
Ensembl Gene ENSMUSG00000009566
Gene Namefolylpolyglutamyl synthetase
Synonyms
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32682609-32704145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32687996 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 138 (I138N)
Ref Sequence ENSEMBL: ENSMUSP00000116434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028148] [ENSMUST00000127812] [ENSMUST00000143743] [ENSMUST00000146498]
Predicted Effect probably damaging
Transcript: ENSMUST00000028148
AA Change: I142N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566
AA Change: I142N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123171
Predicted Effect probably damaging
Transcript: ENSMUST00000127812
AA Change: I138N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566
AA Change: I138N

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142186
Predicted Effect probably benign
Transcript: ENSMUST00000143743
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185043
Meta Mutation Damage Score 0.9543 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Fpgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Fpgs APN 2 32686547 unclassified probably benign
IGL00493:Fpgs APN 2 32687997 missense possibly damaging 0.49
IGL02397:Fpgs APN 2 32685789 missense probably damaging 1.00
IGL02867:Fpgs APN 2 32685879 unclassified probably benign
IGL02889:Fpgs APN 2 32685879 unclassified probably benign
IGL03082:Fpgs APN 2 32685757 nonsense probably null
IGL03126:Fpgs APN 2 32683123 missense possibly damaging 0.86
R0243:Fpgs UTSW 2 32692494 nonsense probably null
R0312:Fpgs UTSW 2 32684801 missense probably damaging 0.99
R1326:Fpgs UTSW 2 32692580 unclassified probably null
R1558:Fpgs UTSW 2 32685840 missense possibly damaging 0.77
R1624:Fpgs UTSW 2 32691188 critical splice donor site probably null
R1934:Fpgs UTSW 2 32687981 missense probably damaging 1.00
R4439:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4440:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4868:Fpgs UTSW 2 32692661 missense probably damaging 1.00
R4979:Fpgs UTSW 2 32687367 unclassified probably benign
R5279:Fpgs UTSW 2 32692767 intron probably benign
R6337:Fpgs UTSW 2 32687941 nonsense probably null
R6648:Fpgs UTSW 2 32684787 nonsense probably null
R6668:Fpgs UTSW 2 32687606 missense probably benign 0.05
R6768:Fpgs UTSW 2 32686623 missense probably benign 0.01
R7134:Fpgs UTSW 2 32686629 missense probably benign 0.25
R7360:Fpgs UTSW 2 32693993 missense possibly damaging 0.91
R7868:Fpgs UTSW 2 32683460 missense probably damaging 1.00
Z1176:Fpgs UTSW 2 32692660 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCACCTTCTCTTGGAGGAAGAC -3'
(R):5'- ATCGTAGGATGAACCCACCG -3'

Sequencing Primer
(F):5'- CCTTCTCTTGGAGGAAGACATGGAAG -3'
(R):5'- TAGGCCTGGCTAGGGACTG -3'
Posted On2015-03-25