Incidental Mutation 'R3706:Hspa4l'
ID271754
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Nameheat shock protein 4 like
Synonyms94kDa, Osp94, APG-1
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40744495-40796103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40781693 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 582 (N582I)
Ref Sequence ENSEMBL: ENSMUSP00000103721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
Predicted Effect probably benign
Transcript: ENSMUST00000077083
AA Change: N603I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: N603I

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108086
AA Change: N582I

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: N582I

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect not run
Transcript: ENSMUST00000162743
AA Change: N111I
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: N603I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: N603I

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40753225 nonsense probably null
IGL02605:Hspa4l APN 3 40781623 missense probably benign 0.20
IGL02719:Hspa4l APN 3 40772658 missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40785408 splice site probably benign
R0398:Hspa4l UTSW 3 40756997 splice site probably benign
R0487:Hspa4l UTSW 3 40784326 missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40779400 missense probably benign 0.01
R0760:Hspa4l UTSW 3 40784723 nonsense probably null
R1491:Hspa4l UTSW 3 40786794 missense probably benign 0.00
R1720:Hspa4l UTSW 3 40781617 nonsense probably null
R1984:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40772658 missense possibly damaging 0.60
R3708:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40785389 missense probably benign 0.29
R3874:Hspa4l UTSW 3 40772642 missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40781594 missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40746003 missense probably benign 0.03
R4364:Hspa4l UTSW 3 40766809 splice site probably null
R4365:Hspa4l UTSW 3 40766809 splice site probably null
R4366:Hspa4l UTSW 3 40766809 splice site probably null
R4493:Hspa4l UTSW 3 40768002 missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40753204 missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40785400 critical splice donor site probably null
R4994:Hspa4l UTSW 3 40745649 utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40745765 missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40786747 missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40781569 missense probably benign 0.17
R5440:Hspa4l UTSW 3 40781576 missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40745745 missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40767979 missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40781599 missense probably benign 0.09
R6515:Hspa4l UTSW 3 40781582 missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40757055 missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40781592 missense probably benign 0.00
R7601:Hspa4l UTSW 3 40784356 critical splice donor site probably null
R8072:Hspa4l UTSW 3 40786746 missense probably damaging 0.98
Z1088:Hspa4l UTSW 3 40766993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAAGACAGCAATAGGTTTGTTTGG -3'
(R):5'- AGAGTTCGCTTCAGAAGGC -3'

Sequencing Primer
(F):5'- ACAGCAATAGGTTTGTTTGGCTTTG -3'
(R):5'- GCAAACCAGATTGCCTAGA -3'
Posted On2015-03-25