Incidental Mutation 'R3706:Crct1'
ID271757
Institutional Source Beutler Lab
Gene Symbol Crct1
Ensembl Gene ENSMUSG00000027913
Gene Namecysteine-rich C-terminal 1
SynonymsNice-1, 2300002G24Rik
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3706 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location93014205-93015687 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 93014707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000029521
AA Change: R41M
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913
AA Change: R41M

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107301
AA Change: R41M
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913
AA Change: R41M

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Meta Mutation Damage Score 0.1444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Crct1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3745:Crct1 UTSW 3 93014707 unclassified probably benign
R3805:Crct1 UTSW 3 93014707 unclassified probably benign
R3925:Crct1 UTSW 3 93014707 unclassified probably benign
R3926:Crct1 UTSW 3 93014707 unclassified probably benign
R4757:Crct1 UTSW 3 93014786 nonsense probably null
R4921:Crct1 UTSW 3 93014825 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGAACTCTGATTGTTGC -3'
(R):5'- AGCCAGACAGACTTTTCTCTAAGG -3'

Sequencing Primer
(F):5'- AACTCTGATTGTTGCAGGAGC -3'
(R):5'- AAGTTCTGTGTTCCACTATAGGGAAG -3'
Posted On2015-03-25