Incidental Mutation 'R3706:Ampd1'
ID271758
Institutional Source Beutler Lab
Gene Symbol Ampd1
Ensembl Gene ENSMUSG00000070385
Gene Nameadenosine monophosphate deaminase 1
SynonymsAmpd-1
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103074014-103099720 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103088311 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034] [ENSMUST00000176440]
Predicted Effect probably benign
Transcript: ENSMUST00000090715
SMART Domains Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 701 5.4e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155034
SMART Domains Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 676 5.2e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176440
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Ampd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ampd1 APN 3 103099694 missense possibly damaging 0.64
IGL00909:Ampd1 APN 3 103088428 missense probably benign 0.10
IGL01543:Ampd1 APN 3 103095713 missense probably benign 0.00
IGL01743:Ampd1 APN 3 103094885 splice site probably benign
IGL02390:Ampd1 APN 3 103079041 missense probably benign 0.28
IGL02637:Ampd1 APN 3 103094883 splice site probably benign
IGL02735:Ampd1 APN 3 103085377 missense probably damaging 1.00
IGL03151:Ampd1 APN 3 103092470 splice site probably null
twinkle_toes UTSW 3 103095646 nonsense probably null
R0158:Ampd1 UTSW 3 103091730 nonsense probably null
R0441:Ampd1 UTSW 3 103088478 missense probably benign 0.05
R0646:Ampd1 UTSW 3 103099597 missense probably damaging 1.00
R1474:Ampd1 UTSW 3 103098838 missense probably damaging 1.00
R1499:Ampd1 UTSW 3 103091664 missense probably damaging 1.00
R1789:Ampd1 UTSW 3 103099126 missense possibly damaging 0.46
R2131:Ampd1 UTSW 3 103094878 critical splice donor site probably null
R4007:Ampd1 UTSW 3 103092460 missense probably damaging 0.99
R4169:Ampd1 UTSW 3 103094841 missense probably damaging 1.00
R4525:Ampd1 UTSW 3 103094733 missense probably damaging 1.00
R4828:Ampd1 UTSW 3 103081097 missense probably damaging 1.00
R5015:Ampd1 UTSW 3 103099665 missense possibly damaging 0.89
R5514:Ampd1 UTSW 3 103079172 missense possibly damaging 0.50
R5839:Ampd1 UTSW 3 103085428 missense possibly damaging 0.47
R5872:Ampd1 UTSW 3 103079130 missense probably benign 0.00
R5890:Ampd1 UTSW 3 103090075 missense probably damaging 1.00
R5986:Ampd1 UTSW 3 103085397 missense probably damaging 1.00
R6272:Ampd1 UTSW 3 103085383 missense possibly damaging 0.50
R6473:Ampd1 UTSW 3 103095646 nonsense probably null
R6504:Ampd1 UTSW 3 103099595 missense possibly damaging 0.90
R7051:Ampd1 UTSW 3 103090073 missense probably damaging 1.00
R7323:Ampd1 UTSW 3 103085380 missense probably benign
R7424:Ampd1 UTSW 3 103088442 missense probably benign 0.05
R7436:Ampd1 UTSW 3 103074119 critical splice donor site probably null
R7546:Ampd1 UTSW 3 103095712 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACTTTGGGAGAATAAGCTTTG -3'
(R):5'- CATCCAGATTTGGGTAAGGGTAGG -3'

Sequencing Primer
(F):5'- TTCTAGGACAGCCAGGGTTAC -3'
(R):5'- GGCTTGGGCTCATCTCTG -3'
Posted On2015-03-25