Incidental Mutation 'R3706:Phox2b'
ID271764
Institutional Source Beutler Lab
Gene Symbol Phox2b
Ensembl Gene ENSMUSG00000012520
Gene Namepaired-like homeobox 2b
SynonymsPmx2b, Phox2b, Dilp1, NBPhox, GENA 269
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location67094399-67099301 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 67096529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012664] [ENSMUST00000174251]
Predicted Effect unknown
Transcript: ENSMUST00000012664
AA Change: K175E
SMART Domains Protein: ENSMUSP00000012664
Gene: ENSMUSG00000012520
AA Change: K175E

DomainStartEndE-ValueType
HOX 98 160 5.75e-27 SMART
low complexity region 209 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174251
SMART Domains Protein: ENSMUSP00000134216
Gene: ENSMUSG00000012520

DomainStartEndE-ValueType
HOX 98 156 1.49e-11 SMART
Meta Mutation Damage Score 0.1129 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for an ethylnitrosourea-induced mutation exhibit dilated pupils and reduced preweaning viability. Other mice heterozygous for mutations in this gene exhibit respiratory failure and specific loss of parafacial interneurons. Homozygotes are inviable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Phox2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Phox2b APN 5 67098919 missense probably damaging 1.00
IGL02197:Phox2b APN 5 67096526 unclassified probably benign
IGL02713:Phox2b APN 5 67096595 unclassified probably benign
R0266:Phox2b UTSW 5 67096625 unclassified probably null
R0632:Phox2b UTSW 5 67096214 unclassified probably benign
R3552:Phox2b UTSW 5 67097656 missense probably damaging 0.98
R4757:Phox2b UTSW 5 67098854 missense probably damaging 1.00
R6484:Phox2b UTSW 5 67097701 missense possibly damaging 0.52
R7110:Phox2b UTSW 5 67096162 missense unknown
R7159:Phox2b UTSW 5 67097585 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACTAAGGCGGCTTTGGC -3'
(R):5'- AAACAGAGTGGGTCTCGAGC -3'

Sequencing Primer
(F):5'- TCTTTGGAGCGAAGATAAGACG -3'
(R):5'- TCTCGAGCGCCACTTTGG -3'
Posted On2015-03-25