Incidental Mutation 'R3706:Immt'
ID271768
Institutional Source Beutler Lab
Gene Symbol Immt
Ensembl Gene ENSMUSG00000052337
Gene Nameinner membrane protein, mitochondrial
Synonymsmitofilin, D830041H16Rik, P87/89, P89, P87, 1700082C19Rik, HMP
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71831331-71877388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71862362 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 226 (M226T)
Ref Sequence ENSEMBL: ENSMUSP00000128967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064062] [ENSMUST00000101301] [ENSMUST00000114151] [ENSMUST00000165331] [ENSMUST00000166938] [ENSMUST00000166975] [ENSMUST00000207003]
Predicted Effect probably benign
Transcript: ENSMUST00000064062
AA Change: M304T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066181
Gene: ENSMUSG00000052337
AA Change: M304T

DomainStartEndE-ValueType
Pfam:Mitofilin 40 745 5e-207 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101301
AA Change: M293T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098859
Gene: ENSMUSG00000052337
AA Change: M293T

DomainStartEndE-ValueType
Pfam:Mitofilin 40 734 3.9e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114151
AA Change: M261T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109788
Gene: ENSMUSG00000052337
AA Change: M261T

DomainStartEndE-ValueType
Pfam:Mitofilin 40 697 1.3e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165331
SMART Domains Protein: ENSMUSP00000128834
Gene: ENSMUSG00000052337

DomainStartEndE-ValueType
Pfam:Mitofilin 40 265 2.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166938
AA Change: M226T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128967
Gene: ENSMUSG00000052337
AA Change: M226T

DomainStartEndE-ValueType
Pfam:Mitofilin 40 667 3.6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166975
AA Change: M226T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128367
Gene: ENSMUSG00000052337
AA Change: M226T

DomainStartEndE-ValueType
Pfam:Mitofilin 40 467 1.1e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205371
Predicted Effect probably benign
Transcript: ENSMUST00000207003
AA Change: M261T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Immt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Immt APN 6 71872858 missense probably damaging 0.99
IGL02085:Immt APN 6 71851836 missense probably benign 0.30
IGL02493:Immt APN 6 71844716 splice site probably benign
glut UTSW 6 71861040 missense probably damaging 1.00
P0045:Immt UTSW 6 71868617 missense possibly damaging 0.88
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0565:Immt UTSW 6 71846483 splice site probably benign
R0671:Immt UTSW 6 71871557 missense possibly damaging 0.95
R0676:Immt UTSW 6 71851844 missense probably benign 0.22
R0718:Immt UTSW 6 71863172 missense probably damaging 1.00
R0789:Immt UTSW 6 71861067 missense probably damaging 1.00
R0980:Immt UTSW 6 71874326 missense probably benign 0.19
R1332:Immt UTSW 6 71846272 splice site probably benign
R1688:Immt UTSW 6 71857011 missense probably damaging 1.00
R2106:Immt UTSW 6 71871515 missense possibly damaging 0.80
R2149:Immt UTSW 6 71844675 nonsense probably null
R4393:Immt UTSW 6 71872800 missense probably benign 0.04
R4543:Immt UTSW 6 71851778 missense probably damaging 0.97
R4645:Immt UTSW 6 71856939 missense probably damaging 1.00
R4774:Immt UTSW 6 71852736 missense probably damaging 1.00
R5535:Immt UTSW 6 71852784 missense probably null 1.00
R5920:Immt UTSW 6 71863196 missense probably benign 0.18
R7002:Immt UTSW 6 71861040 missense probably damaging 1.00
R7266:Immt UTSW 6 71874705 missense probably benign 0.26
R7326:Immt UTSW 6 71846369 missense probably damaging 1.00
R8185:Immt UTSW 6 71872851 nonsense probably null
R8200:Immt UTSW 6 71871437 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATAGAAACCGACAGAGGTCTC -3'
(R):5'- AACTTGTTTTGTGAAAGCGTGT -3'

Sequencing Primer
(F):5'- GAAACCGACAGAGGTCTCTTGTTC -3'
(R):5'- GGCATCACAGTCTATTACAGATGGC -3'
Posted On2015-03-25