Incidental Mutation 'R3706:Cd4'
ID271769
Institutional Source Beutler Lab
Gene Symbol Cd4
Ensembl Gene ENSMUSG00000023274
Gene NameCD4 antigen
SynonymsL3T4, Ly-4
MMRRC Submission 040699-MU
Accession Numbers

Genbank: NM_013488; MGI: 88335

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124864692-124888221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124879388 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 47 (K47E)
Ref Sequence ENSEMBL: ENSMUSP00000024044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024044]
Predicted Effect probably benign
Transcript: ENSMUST00000024044
AA Change: K47E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: K47E

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151594
Meta Mutation Damage Score 0.3847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

 All alleles(25) : Targeted(13) Gene trapped(6) Spontaneous(2) Chemically induced(4)          

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Cd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTGGGCTTCTAGGAATAAGG -3'
(R):5'- TGCCGAGCCATCTCTCTTAG -3'

Sequencing Primer
(F):5'- GGCTTCTAGGAATAAGGTTCATTC -3'
(R):5'- CTGCAGCTGTGTAAGTTTTCTGAC -3'
Posted On2015-03-25