Incidental Mutation 'R3706:Zim1'
ID271770
Institutional Source Beutler Lab
Gene Symbol Zim1
Ensembl Gene ENSMUSG00000002266
Gene Namezinc finger, imprinted 1
Synonyms
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6671269-6696450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6677291 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 458 (I458V)
Ref Sequence ENSEMBL: ENSMUSP00000145453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002336] [ENSMUST00000122432] [ENSMUST00000203908]
Predicted Effect probably damaging
Transcript: ENSMUST00000002336
AA Change: I458V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002336
Gene: ENSMUSG00000002266
AA Change: I458V

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122432
AA Change: I458V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113585
Gene: ENSMUSG00000002266
AA Change: I458V

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203908
AA Change: I458V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145453
Gene: ENSMUSG00000002266
AA Change: I458V

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Zim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Zim1 APN 7 6682760 missense possibly damaging 0.95
IGL01921:Zim1 APN 7 6682185 splice site probably benign
IGL02116:Zim1 APN 7 6678254 missense probably benign 0.00
IGL02252:Zim1 APN 7 6688628 missense unknown
IGL02354:Zim1 APN 7 6682874 splice site probably null
IGL02361:Zim1 APN 7 6682874 splice site probably null
IGL03025:Zim1 APN 7 6682059 missense probably benign 0.00
R0003:Zim1 UTSW 7 6676948 missense probably benign 0.01
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1483:Zim1 UTSW 7 6682125 missense probably benign 0.00
R2106:Zim1 UTSW 7 6678074 missense probably benign 0.02
R2315:Zim1 UTSW 7 6677068 missense possibly damaging 0.86
R2508:Zim1 UTSW 7 6677430 small insertion probably benign
R2508:Zim1 UTSW 7 6677431 small insertion probably benign
R3975:Zim1 UTSW 7 6677130 missense probably damaging 1.00
R5524:Zim1 UTSW 7 6677321 missense probably benign 0.34
R5557:Zim1 UTSW 7 6677711 missense probably damaging 1.00
R5843:Zim1 UTSW 7 6677698 missense possibly damaging 0.59
R5844:Zim1 UTSW 7 6678116 missense probably benign 0.21
R5882:Zim1 UTSW 7 6682738 critical splice donor site probably null
R6828:Zim1 UTSW 7 6677689 missense probably damaging 1.00
R6953:Zim1 UTSW 7 6687707 missense unknown
R7080:Zim1 UTSW 7 6677306 missense possibly damaging 0.92
R7148:Zim1 UTSW 7 6678221 missense possibly damaging 0.91
R7199:Zim1 UTSW 7 6677873 nonsense probably null
R7332:Zim1 UTSW 7 6677353 missense probably damaging 1.00
R7462:Zim1 UTSW 7 6677812 missense probably damaging 1.00
Z1088:Zim1 UTSW 7 6677659 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCGCATGGATCTGGCCTA -3'
(R):5'- CCAGACCCTCCACCTCGTG -3'

Sequencing Primer
(F):5'- TGGCACACGAAAGGTTTCTC -3'
(R):5'- ACCCTTTAAATGTGACGAGTGCG -3'
Posted On2015-03-25