Incidental Mutation 'R3706:Anxa10'
ID271773
Institutional Source Beutler Lab
Gene Symbol Anxa10
Ensembl Gene ENSMUSG00000031635
Gene Nameannexin A10
Synonyms
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location62057042-62123150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62064287 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 167 (K167M)
Ref Sequence ENSEMBL: ENSMUSP00000034054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034052] [ENSMUST00000034054]
Predicted Effect probably damaging
Transcript: ENSMUST00000034052
AA Change: K187M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034052
Gene: ENSMUSG00000031635
AA Change: K187M

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 158 8.13e-15 SMART
ANX 198 241 5.48e-2 SMART
ANX 264 316 6.51e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034054
AA Change: K167M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034054
Gene: ENSMUSG00000031635
AA Change: K167M

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 161 2.38e-1 SMART
ANX 178 221 5.48e-2 SMART
ANX 244 296 6.51e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210799
Meta Mutation Damage Score 0.3623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Litter sizes from crosses of females that are either homozygous or heterozygous for a null allele contain fewer pups than wild-type females, indicating a dominant maternal effect on embryonic lethality. Embryos of homozygous null females die between E4.5 and E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Anxa10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Anxa10 APN 8 62076314 missense probably damaging 1.00
IGL03354:Anxa10 APN 8 62096744 missense probably damaging 1.00
R0687:Anxa10 UTSW 8 62092572 missense possibly damaging 0.69
R0826:Anxa10 UTSW 8 62076284 nonsense probably null
R0883:Anxa10 UTSW 8 62077967 missense probably benign 0.40
R0945:Anxa10 UTSW 8 62060245 splice site probably benign
R1124:Anxa10 UTSW 8 62061004 splice site probably null
R1647:Anxa10 UTSW 8 62092584 missense probably damaging 1.00
R2877:Anxa10 UTSW 8 62060339 missense probably damaging 1.00
R4677:Anxa10 UTSW 8 62063020 missense probably damaging 1.00
R5109:Anxa10 UTSW 8 62063059 missense possibly damaging 0.91
R5554:Anxa10 UTSW 8 62061046 missense possibly damaging 0.93
R5971:Anxa10 UTSW 8 62077926 missense probably benign 0.00
R6079:Anxa10 UTSW 8 62077926 missense probably benign 0.00
R6134:Anxa10 UTSW 8 62077943 missense probably damaging 1.00
R6857:Anxa10 UTSW 8 62061017 missense probably benign 0.19
R6901:Anxa10 UTSW 8 62096782 missense probably damaging 1.00
R7428:Anxa10 UTSW 8 62092509 missense probably benign 0.01
Z1088:Anxa10 UTSW 8 62092506 missense probably damaging 0.97
Z1176:Anxa10 UTSW 8 62063070 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGAGCTTTATTCTGTTGCAG -3'
(R):5'- TATTCCACAGGCAAACAGGGAG -3'

Sequencing Primer
(F):5'- GACGTAATTCAGTACAGTAATTGGC -3'
(R):5'- CAGGCAAACAGGGAGGAAGGATAC -3'
Posted On2015-03-25