Mutagenetix > Incidental Mutation

Incidental Mutation 'R3706:Lama2'

271779

Institutional Source

Beutler Lab

Gene Symbol

Lama2

Ensembl Gene

ENSMUSG00000019899

Gene Name

laminin, alpha 2

Synonyms

merosin, mer

MMRRC Submission

040699-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R3706 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

26980036-27619758 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27138996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1572 (D1572G)

Ref Sequence

ENSEMBL: ENSMUSP00000090304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092639]

AlphaFold

no structure available at present

PDB Structure

LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092639
AA Change: D1572G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: D1572G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	29	281	5.35e-129	SMART
EGF_Lam	283	337	2.11e-4	SMART
EGF_Lam	340	407	1.59e-8	SMART
EGF_Lam	410	462	5.44e-7	SMART
EGF_Lam	465	511	9.05e-4	SMART
LamB	574	706	2.26e-44	SMART
Pfam:Laminin_EGF	715	745	2.8e-4	PFAM
EGF_Lam	753	800	4.03e-10	SMART
EGF_Lam	803	858	3.01e-9	SMART
EGF_Lam	861	911	1.35e-11	SMART
EGF_Lam	914	960	7.23e-12	SMART
EGF_Lam	963	1007	5.87e-12	SMART
EGF_Lam	1010	1053	1.28e-12	SMART
EGF_Lam	1056	1099	2.37e-7	SMART
EGF_Lam	1102	1159	3.22e-9	SMART
LamB	1225	1360	1.95e-57	SMART
EGF_like	1364	1413	8.13e-1	SMART
EGF_Lam	1416	1462	5.48e-12	SMART
EGF_Lam	1465	1520	1.27e-7	SMART
EGF_Lam	1523	1567	2.4e-8	SMART
Pfam:Laminin_I	1584	1849	2e-92	PFAM
Blast:MA	1881	2113	1e-112	BLAST
LamG	2162	2307	1.28e-25	SMART
LamG	2356	2500	2.2e-33	SMART
LamG	2542	2688	3.31e-28	SMART
low complexity region	2725	2741	N/A	INTRINSIC
LamG	2781	2914	2.25e-39	SMART
LamG	2956	3092	1.53e-32	SMART

Meta Mutation Damage Score

0.2987

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,259,816	S2917P	unknown	Het
Ahnak2	G	A	12: 112,773,651	P523L	possibly damaging	Het
Ampd1	A	G	3: 103,088,311		probably benign	Het
Anxa10	T	A	8: 62,064,287	K167M	probably damaging	Het
Atp8b2	A	T	3: 89,945,152	F866I	probably damaging	Het
Atxn2	T	C	5: 121,785,868		probably null	Het
Card11	G	A	5: 140,887,135	R608C	probably damaging	Het
Cd4	T	C	6: 124,879,388	K47E	probably benign	Het
Cenpl	G	A	1: 161,078,415	V120M	probably damaging	Het
Cfap69	G	T	5: 5,613,843	Y461*	probably null	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Ddx24	A	T	12: 103,417,416	V592E	probably damaging	Het
Dmc1	G	C	15: 79,562,581	P264A	probably damaging	Het
Donson	A	G	16: 91,686,161		probably benign	Het
Elovl5	C	A	9: 77,979,837	A170E	probably null	Het
Emilin1	A	G	5: 30,917,822	E469G	possibly damaging	Het
Fam178b	A	G	1: 36,608,448	Y235H	probably damaging	Het
Fgfr2	T	C	7: 130,198,431	T358A	probably benign	Het
Fpgs	A	T	2: 32,687,996	I138N	probably damaging	Het
Glb1l2	A	G	9: 26,771,020		probably benign	Het
Hspa4l	A	T	3: 40,781,693	N582I	possibly damaging	Het
Immt	T	C	6: 71,862,362	M226T	probably benign	Het
Kif21b	A	G	1: 136,159,410	N875S	probably benign	Het
Lelp1	A	C	3: 92,135,407	C112G	unknown	Het
Mctp2	A	G	7: 72,214,111		probably benign	Het
Mettl2	T	A	11: 105,139,726	I376N	probably benign	Het
Mycbp2	A	T	14: 103,156,414	S2904T	probably benign	Het
Nwd1	A	G	8: 72,667,116	T377A	possibly damaging	Het
Olfr1445	C	T	19: 12,883,896	T5I	probably damaging	Het
Olfr1494	T	A	19: 13,749,112	L2Q	probably benign	Het
Pappa2	A	T	1: 158,834,918	Y1162*	probably null	Het
Phip	T	C	9: 82,900,743	E883G	probably benign	Het
Phox2b	T	C	5: 67,096,529		probably benign	Het
Pigc	T	A	1: 161,971,094	M215K	probably benign	Het
Rab11b	G	C	17: 33,747,766	H162D	probably benign	Het
Reln	T	C	5: 21,995,589		probably benign	Het
Sgo2b	T	C	8: 63,928,145	E551G	probably damaging	Het
Sucla2	A	G	14: 73,591,052	K336R	probably damaging	Het
Zfx	A	G	X: 94,098,807	V36A	possibly damaging	Het
Zim1	T	C	7: 6,677,291	I458V	probably damaging	Het

Other mutations in Lama2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Lama2	APN	10	27188265	missense	probably benign	0.01
IGL00467:Lama2	APN	10	27467197	splice site	probably benign
IGL00470:Lama2	APN	10	27243742	missense	probably benign	0.22
IGL00517:Lama2	APN	10	27197330	missense	probably benign	0.01
IGL00541:Lama2	APN	10	27188306	missense	probably benign	0.14
IGL00931:Lama2	APN	10	27006776	missense	possibly damaging	0.92
IGL00951:Lama2	APN	10	27030285	missense	probably benign	0.03
IGL00988:Lama2	APN	10	27369015	nonsense	probably null
IGL01098:Lama2	APN	10	27031112	missense	possibly damaging	0.66
IGL01152:Lama2	APN	10	27208429	missense	probably benign	0.00
IGL01293:Lama2	APN	10	27231636	missense	probably benign	0.38
IGL01338:Lama2	APN	10	27188272	missense	probably benign	0.13
IGL01609:Lama2	APN	10	27344421	missense	probably benign	0.03
IGL01643:Lama2	APN	10	27070372	splice site	probably benign
IGL01675:Lama2	APN	10	27188054	missense	possibly damaging	0.77
IGL01681:Lama2	APN	10	27265045	missense	probably benign	0.33
IGL01694:Lama2	APN	10	27006742	missense	possibly damaging	0.75
IGL01705:Lama2	APN	10	27189274	splice site	probably benign
IGL01885:Lama2	APN	10	27105139	nonsense	probably null
IGL01935:Lama2	APN	10	27422604	missense	probably damaging	0.98
IGL01994:Lama2	APN	10	27467203	critical splice donor site	probably null
IGL02041:Lama2	APN	10	26984326	missense	probably damaging	1.00
IGL02067:Lama2	APN	10	27176796	missense	probably benign	0.02
IGL02097:Lama2	APN	10	27138960	missense	probably benign	0.09
IGL02179:Lama2	APN	10	27070364	missense	probably benign	0.01
IGL02268:Lama2	APN	10	27001116	splice site	probably benign
IGL02302:Lama2	APN	10	27212043	missense	probably benign	0.06
IGL02363:Lama2	APN	10	27366066	missense	probably damaging	1.00
IGL02378:Lama2	APN	10	27043656	missense	probably damaging	0.99
IGL02642:Lama2	APN	10	27467273	missense	probably damaging	1.00
IGL02676:Lama2	APN	10	27118493	missense	probably benign	0.00
IGL02695:Lama2	APN	10	27000775	missense	probably benign
IGL02735:Lama2	APN	10	27104128	missense	probably damaging	1.00
IGL02794:Lama2	APN	10	27041231	missense	possibly damaging	0.73
IGL02823:Lama2	APN	10	27001145	missense	probably damaging	1.00
IGL02869:Lama2	APN	10	27015538	missense	probably damaging	0.99
IGL02942:Lama2	APN	10	27041220	missense	probably damaging	1.00
IGL03201:Lama2	APN	10	27344570	nonsense	probably null
IGL03268:Lama2	APN	10	27422653	missense	probably damaging	1.00
IGL03288:Lama2	APN	10	27369051	missense	probably damaging	1.00
IGL03380:Lama2	APN	10	27050265	missense	probably damaging	1.00
IGL03407:Lama2	APN	10	27347021	missense	probably damaging	1.00
cowboy	UTSW	10	27043643	frame shift	probably null
petri	UTSW	10	26993398	splice site	probably null
PIT4362001:Lama2	UTSW	10	27369136	missense	probably damaging	1.00
PIT4382001:Lama2	UTSW	10	27204905	missense	probably damaging	1.00
PIT4431001:Lama2	UTSW	10	27101430	missense	probably damaging	1.00
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0114:Lama2	UTSW	10	26993068	nonsense	probably null
R0142:Lama2	UTSW	10	27187845	missense	probably benign
R0313:Lama2	UTSW	10	26993398	splice site	probably null
R0376:Lama2	UTSW	10	27015546	missense	possibly damaging	0.68
R0412:Lama2	UTSW	10	27190625	missense	possibly damaging	0.58
R0472:Lama2	UTSW	10	26990867	missense	probably damaging	1.00
R0607:Lama2	UTSW	10	27189131	missense	probably benign	0.34
R0648:Lama2	UTSW	10	26989376	missense	probably benign	0.00
R0667:Lama2	UTSW	10	27344410	splice site	probably null
R0760:Lama2	UTSW	10	27044433	critical splice donor site	probably null
R1240:Lama2	UTSW	10	27041124	missense	probably damaging	1.00
R1385:Lama2	UTSW	10	27224043	missense	probably benign	0.11
R1433:Lama2	UTSW	10	27187754	missense	probably damaging	1.00
R1434:Lama2	UTSW	10	27208370	missense	probably damaging	1.00
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1645:Lama2	UTSW	10	27368985	missense	probably damaging	1.00
R1702:Lama2	UTSW	10	27190529	missense	probably benign
R1703:Lama2	UTSW	10	27266671	missense	probably damaging	1.00
R1769:Lama2	UTSW	10	27208406	missense	probably damaging	1.00
R1769:Lama2	UTSW	10	27208407	missense	probably benign
R1846:Lama2	UTSW	10	27212096	missense	probably damaging	1.00
R1859:Lama2	UTSW	10	27031082	missense	possibly damaging	0.51
R1871:Lama2	UTSW	10	26984494	missense	probably damaging	1.00
R1903:Lama2	UTSW	10	27188399	missense	probably damaging	1.00
R1906:Lama2	UTSW	10	27056527	critical splice donor site	probably null
R1958:Lama2	UTSW	10	26981598	missense	probably damaging	0.97
R1959:Lama2	UTSW	10	27422618	missense	probably damaging	1.00
R1977:Lama2	UTSW	10	26990800	splice site	probably null
R2063:Lama2	UTSW	10	27164926	missense	probably damaging	1.00
R2079:Lama2	UTSW	10	27369053	missense	probably damaging	0.99
R2085:Lama2	UTSW	10	27204841	nonsense	probably null
R2125:Lama2	UTSW	10	27044453	nonsense	probably null
R2140:Lama2	UTSW	10	27054694	splice site	probably null
R2219:Lama2	UTSW	10	27043569	missense	probably damaging	0.99
R2259:Lama2	UTSW	10	27031127	missense	probably benign	0.00
R2265:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2266:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R2267:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2268:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2269:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2862:Lama2	UTSW	10	27422612	nonsense	probably null
R2912:Lama2	UTSW	10	27000803	missense	probably benign
R2999:Lama2	UTSW	10	26989421	missense	probably benign	0.18
R3034:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3081:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3107:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3109:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3436:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3437:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3780:Lama2	UTSW	10	27459339	missense	probably damaging	1.00
R3807:Lama2	UTSW	10	27190665	frame shift	probably null
R3919:Lama2	UTSW	10	27118505	missense	probably damaging	1.00
R4014:Lama2	UTSW	10	26984376	missense	probably damaging	1.00
R4131:Lama2	UTSW	10	27041174	missense	probably benign	0.00
R4190:Lama2	UTSW	10	27266664	missense	probably damaging	0.96
R4273:Lama2	UTSW	10	27347054	missense	probably damaging	1.00
R4358:Lama2	UTSW	10	26984493	missense	probably damaging	1.00
R4407:Lama2	UTSW	10	27212128	small deletion	probably benign
R4415:Lama2	UTSW	10	26989344	nonsense	probably null
R4426:Lama2	UTSW	10	27422558	missense	probably damaging	1.00
R4590:Lama2	UTSW	10	26989414	missense	probably benign	0.00
R4615:Lama2	UTSW	10	26981524	missense	probably damaging	0.99
R4736:Lama2	UTSW	10	27204929	missense	probably damaging	1.00
R4754:Lama2	UTSW	10	27118531	missense	possibly damaging	0.58
R4791:Lama2	UTSW	10	27467271	missense	probably damaging	1.00
R4834:Lama2	UTSW	10	27006749	missense	probably benign	0.30
R4856:Lama2	UTSW	10	27043643	frame shift	probably null
R4858:Lama2	UTSW	10	27043643	frame shift	probably null
R4859:Lama2	UTSW	10	27043643	frame shift	probably null
R4897:Lama2	UTSW	10	27043643	frame shift	probably null
R4898:Lama2	UTSW	10	27043643	frame shift	probably null
R4899:Lama2	UTSW	10	27043643	frame shift	probably null
R4907:Lama2	UTSW	10	27164946	missense	probably benign	0.11
R4911:Lama2	UTSW	10	27138927	missense	probably damaging	1.00
R4924:Lama2	UTSW	10	27369141	missense	probably damaging	0.98
R5023:Lama2	UTSW	10	27190504	missense	probably damaging	0.97
R5057:Lama2	UTSW	10	27164986	missense	probably damaging	1.00
R5070:Lama2	UTSW	10	27350251	critical splice donor site	probably null
R5116:Lama2	UTSW	10	27118560	missense	probably benign	0.08
R5177:Lama2	UTSW	10	27190703	missense	possibly damaging	0.94
R5198:Lama2	UTSW	10	27347003	missense	probably damaging	0.96
R5289:Lama2	UTSW	10	27212073	nonsense	probably null
R5327:Lama2	UTSW	10	27138946	missense	probably benign
R5424:Lama2	UTSW	10	26984396	missense	probably damaging	1.00
R5469:Lama2	UTSW	10	27041189	missense	possibly damaging	0.92
R5620:Lama2	UTSW	10	26990880	missense	probably damaging	0.99
R5667:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5671:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5815:Lama2	UTSW	10	26986851	missense	probably damaging	1.00
R5917:Lama2	UTSW	10	27190697	missense	probably damaging	1.00
R5935:Lama2	UTSW	10	27015498	missense	probably benign
R5976:Lama2	UTSW	10	27190676	missense	probably benign	0.00
R5979:Lama2	UTSW	10	27235732	missense	probably damaging	0.99
R6004:Lama2	UTSW	10	27235785	missense	probably benign	0.01
R6180:Lama2	UTSW	10	26981499	missense	probably benign	0.03
R6198:Lama2	UTSW	10	27188022	missense	probably damaging	1.00
R6257:Lama2	UTSW	10	26986899	missense	possibly damaging	0.85
R6271:Lama2	UTSW	10	27023329	missense	possibly damaging	0.67
R6322:Lama2	UTSW	10	27190547	missense	probably damaging	0.96
R6354:Lama2	UTSW	10	27212068	missense	probably damaging	1.00
R6431:Lama2	UTSW	10	27053031	missense	possibly damaging	0.50
R6499:Lama2	UTSW	10	27031158	missense	probably damaging	1.00
R6535:Lama2	UTSW	10	27104131	missense	probably damaging	1.00
R6545:Lama2	UTSW	10	27176797	missense	probably benign
R6636:Lama2	UTSW	10	27124568	missense	probably benign	0.13
R6891:Lama2	UTSW	10	27328072	nonsense	probably null
R6891:Lama2	UTSW	10	27328082	nonsense	probably null
R6902:Lama2	UTSW	10	26981629	missense	probably damaging	1.00
R6908:Lama2	UTSW	10	27031196	splice site	probably null
R7168:Lama2	UTSW	10	27366152	critical splice acceptor site	probably null
R7233:Lama2	UTSW	10	27231663	missense	probably damaging	1.00
R7272:Lama2	UTSW	10	27124556	missense	probably damaging	1.00
R7274:Lama2	UTSW	10	27119980	missense	probably damaging	0.99
R7419:Lama2	UTSW	10	27266634	missense	probably benign
R7423:Lama2	UTSW	10	27212226	missense	probably benign	0.00
R7554:Lama2	UTSW	10	27155496	missense	probably damaging	1.00
R7569:Lama2	UTSW	10	27265050	missense	probably damaging	1.00
R7574:Lama2	UTSW	10	27006730	missense	probably benign	0.03
R7584:Lama2	UTSW	10	27104261	missense	possibly damaging	0.78
R7586:Lama2	UTSW	10	27101393	missense	probably benign	0.00
R7603:Lama2	UTSW	10	27266680	missense	possibly damaging	0.55
R7691:Lama2	UTSW	10	27208393	missense	possibly damaging	0.67
R7750:Lama2	UTSW	10	26990924	missense	probably damaging	0.97
R7841:Lama2	UTSW	10	27155533	missense	probably benign	0.00
R7864:Lama2	UTSW	10	27056615	missense	probably benign	0.08
R7960:Lama2	UTSW	10	26993098	missense	probably benign	0.04
R7964:Lama2	UTSW	10	27223981	critical splice donor site	probably null
R7980:Lama2	UTSW	10	27363613	missense	probably damaging	0.98
R8013:Lama2	UTSW	10	27344498	missense	probably benign	0.00
R8028:Lama2	UTSW	10	27328149	missense	probably benign	0.13
R8097:Lama2	UTSW	10	27190664	nonsense	probably null
R8100:Lama2	UTSW	10	27041117	missense	probably benign	0.03
R8110:Lama2	UTSW	10	26990870	missense	probably damaging	1.00
R8122:Lama2	UTSW	10	27054596	missense	possibly damaging	0.87
R8264:Lama2	UTSW	10	27467222	missense	probably benign	0.07
R8315:Lama2	UTSW	10	27422659	missense	probably damaging	1.00
R8318:Lama2	UTSW	10	26984338	missense	probably damaging	1.00
R8419:Lama2	UTSW	10	27422563	missense	probably benign	0.26
R8475:Lama2	UTSW	10	27101373	missense	possibly damaging	0.69
R8735:Lama2	UTSW	10	27190534	missense	probably damaging	1.00
R8754:Lama2	UTSW	10	27001151	missense	possibly damaging	0.83
R8817:Lama2	UTSW	10	27187873	missense	probably damaging	1.00
R8851:Lama2	UTSW	10	27366123	missense	possibly damaging	0.94
R8859:Lama2	UTSW	10	27459388	missense	possibly damaging	0.58
R8886:Lama2	UTSW	10	27369161	splice site	probably benign
R8937:Lama2	UTSW	10	26986820	missense	probably damaging	1.00
R8993:Lama2	UTSW	10	27422714	missense	possibly damaging	0.91
R9025:Lama2	UTSW	10	26984371	missense	probably benign	0.00
R9027:Lama2	UTSW	10	27204885	missense	probably damaging	1.00
R9047:Lama2	UTSW	10	27006701	missense	possibly damaging	0.50
R9075:Lama2	UTSW	10	26981592	missense	probably damaging	1.00
R9135:Lama2	UTSW	10	27422519	missense	probably damaging	1.00
R9165:Lama2	UTSW	10	27053026	critical splice donor site	probably null
R9192:Lama2	UTSW	10	27328185	missense	possibly damaging	0.95
R9254:Lama2	UTSW	10	27422689	missense	probably damaging	0.96
R9326:Lama2	UTSW	10	27030197	missense	probably benign	0.04
R9356:Lama2	UTSW	10	27212190	missense	probably damaging	0.99
R9358:Lama2	UTSW	10	27188382	missense	possibly damaging	0.95
R9358:Lama2	UTSW	10	27616765	missense	unknown
R9376:Lama2	UTSW	10	27118624	missense	probably benign	0.11
R9381:Lama2	UTSW	10	27188027	nonsense	probably null
R9397:Lama2	UTSW	10	27105121	missense	probably benign	0.01
R9460:Lama2	UTSW	10	27422479	missense	probably damaging	1.00
R9478:Lama2	UTSW	10	27015482	missense	probably damaging	0.98
R9503:Lama2	UTSW	10	26989444	missense	possibly damaging	0.57
R9514:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9515:Lama2	UTSW	10	27001174	missense	probably benign	0.23
R9516:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9533:Lama2	UTSW	10	26986875	missense	probably damaging	1.00
R9619:Lama2	UTSW	10	27188286	missense	probably damaging	1.00
R9721:Lama2	UTSW	10	27467342	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ACAGTTCTCTGGTTTGAAACACC -3'
(R):5'- AGCTGTGGACTGGGTGATAAC -3'

Sequencing Primer
(F):5'- AGACCATTTGGACTGCCTCG -3'
(R):5'- ACATTAATTATCTGAGATGCTGCATC -3'

Posted On

2015-03-25