Incidental Mutation 'R3706:Dmc1'
ID271787
Institutional Source Beutler Lab
Gene Symbol Dmc1
Ensembl Gene ENSMUSG00000022429
Gene NameDNA meiotic recombinase 1
SynonymsDmc1h, sgdp, Dmc1, Mei11
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79561497-79605109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 79562581 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 264 (P264A)
Ref Sequence ENSEMBL: ENSMUSP00000155228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023065] [ENSMUST00000229408] [ENSMUST00000230011]
Predicted Effect probably damaging
Transcript: ENSMUST00000023065
AA Change: P319A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023065
Gene: ENSMUSG00000022429
AA Change: P319A

DomainStartEndE-ValueType
HhH1 57 76 8.07e0 SMART
AAA 118 307 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229408
AA Change: P264A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229472
Predicted Effect probably benign
Transcript: ENSMUST00000230011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230121
Meta Mutation Damage Score 0.8197 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations are sterile with failure of homologous pairing in meiotic prophase in males and disrupted oogenesis in embryonic females with absence of germ cells in the adult ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Dmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Dmc1 APN 15 79596280 missense probably benign 0.11
IGL02817:Dmc1 APN 15 79588763 missense probably damaging 1.00
IGL03131:Dmc1 APN 15 79568691 missense probably benign 0.02
IGL03341:Dmc1 APN 15 79562545 missense probably benign 0.01
R0129:Dmc1 UTSW 15 79596240 splice site probably benign
R0395:Dmc1 UTSW 15 79588772 missense probably damaging 1.00
R0908:Dmc1 UTSW 15 79585689 missense probably damaging 1.00
R2219:Dmc1 UTSW 15 79585126 missense possibly damaging 0.77
R6362:Dmc1 UTSW 15 79588823 missense probably benign 0.42
R7499:Dmc1 UTSW 15 79602420 nonsense probably null
R7619:Dmc1 UTSW 15 79596242 critical splice donor site probably null
R8270:Dmc1 UTSW 15 79601545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGCATATCAGGAAGGAAC -3'
(R):5'- CAATGTTTGCGAGGGTTGATAAC -3'

Sequencing Primer
(F):5'- ATATAAGCTTCACATCGCTTTTGCTG -3'
(R):5'- GGGTTGATAACTCTGCTAGGTAAG -3'
Posted On2015-03-25