Incidental Mutation 'R3706:Olfr1445'
ID271790
Institutional Source Beutler Lab
Gene Symbol Olfr1445
Ensembl Gene ENSMUSG00000045126
Gene Nameolfactory receptor 1445
SynonymsGA_x6K02T2RE5P-3213352-3214296, MOR202-7
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12883855-12884855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12883896 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 5 (T5I)
Ref Sequence ENSEMBL: ENSMUSP00000058933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049624] [ENSMUST00000216805]
Predicted Effect probably damaging
Transcript: ENSMUST00000049624
AA Change: T5I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058933
Gene: ENSMUSG00000045126
AA Change: T5I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-54 PFAM
Pfam:7tm_1 39 288 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216805
Meta Mutation Damage Score 0.2551 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Olfr1445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr1445 APN 19 12883901 missense probably benign 0.03
IGL01786:Olfr1445 APN 19 12884277 missense probably damaging 0.99
IGL02375:Olfr1445 APN 19 12883941 missense probably benign 0.00
IGL03220:Olfr1445 APN 19 12884451 missense possibly damaging 0.80
IGL03232:Olfr1445 APN 19 12884272 nonsense probably null
R0505:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0505:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R0541:Olfr1445 UTSW 19 12884094 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R2187:Olfr1445 UTSW 19 12884255 missense probably damaging 1.00
R2231:Olfr1445 UTSW 19 12883949 missense probably benign 0.00
R4698:Olfr1445 UTSW 19 12884621 missense probably benign 0.08
R5558:Olfr1445 UTSW 19 12884387 missense probably benign 0.01
R6163:Olfr1445 UTSW 19 12884108 missense probably damaging 1.00
R7057:Olfr1445 UTSW 19 12884642 missense probably damaging 0.98
R7063:Olfr1445 UTSW 19 12884085 missense probably damaging 1.00
R7705:Olfr1445 UTSW 19 12884507 missense probably benign 0.01
R8073:Olfr1445 UTSW 19 12884616 missense probably benign 0.00
R8174:Olfr1445 UTSW 19 12883904 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAATTTTGCTGCCTCAGTCTG -3'
(R):5'- ATTACTTTGGGAGTGACAGCTG -3'

Sequencing Primer
(F):5'- CAGTCTGCTTGGATCAGAATGC -3'
(R):5'- GTCCACCAGAGATAGATGACTG -3'
Posted On2015-03-25