Incidental Mutation 'R3706:Olfr1494'
ID271791
Institutional Source Beutler Lab
Gene Symbol Olfr1494
Ensembl Gene ENSMUSG00000050865
Gene Nameolfactory receptor 1494
SynonymsMOR266-1, GA_x6K02T2RE5P-4082427-4083374
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3706 (G1)
Quality Score130
Status Validated
Chromosome19
Chromosomal Location13739728-13750479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13749112 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2 (L2Q)
Ref Sequence ENSEMBL: ENSMUSP00000146563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051768] [ENSMUST00000207836]
Predicted Effect probably benign
Transcript: ENSMUST00000051768
AA Change: L2Q

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056291
Gene: ENSMUSG00000050865
AA Change: L2Q

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
Pfam:7tm_4 35 313 3.2e-53 PFAM
Pfam:7tm_1 45 295 7.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207836
AA Change: L2Q

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214697
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Olfr1494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1494 APN 19 13749801 missense probably benign 0.04
IGL02335:Olfr1494 APN 19 13749934 missense probably benign 0.01
IGL02388:Olfr1494 APN 19 13749630 missense possibly damaging 0.91
IGL03231:Olfr1494 APN 19 13749385 missense probably benign 0.35
R0133:Olfr1494 UTSW 19 13749988 missense probably damaging 1.00
R0142:Olfr1494 UTSW 19 13749255 missense probably benign 0.00
R0561:Olfr1494 UTSW 19 13749298 missense probably damaging 1.00
R0783:Olfr1494 UTSW 19 13749676 missense probably damaging 0.99
R1826:Olfr1494 UTSW 19 13749347 missense probably benign 0.05
R1967:Olfr1494 UTSW 19 13750053 makesense probably null
R5417:Olfr1494 UTSW 19 13749853 missense probably benign 0.18
R6508:Olfr1494 UTSW 19 13749354 missense probably damaging 1.00
R7126:Olfr1494 UTSW 19 13749523 missense possibly damaging 0.90
R7262:Olfr1494 UTSW 19 13749171 missense probably benign 0.02
R7395:Olfr1494 UTSW 19 13749138 missense probably damaging 0.98
R7740:Olfr1494 UTSW 19 13749964 missense probably benign 0.00
R7744:Olfr1494 UTSW 19 13750055 makesense probably null
R7864:Olfr1494 UTSW 19 13749346 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCTGTAGACAAACATCTCCATTAC -3'
(R):5'- TTTCCAAGACAGACAGACTACTGAGG -3'

Sequencing Primer
(F):5'- GTCAGATTCAGTCTCCCT -3'
(R):5'- ATACATAGGTGTGTGCAGGGC -3'
Posted On2015-03-25