Incidental Mutation 'R3706:Zfx'
ID271793
Institutional Source Beutler Lab
Gene Symbol Zfx
Ensembl Gene ENSMUSG00000079509
Gene Namezinc finger protein X-linked
SynonymsZfx5, Zfx6, Zfx5,6
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R3706 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location94074631-94123702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94098807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000109558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088102] [ENSMUST00000113925] [ENSMUST00000113926] [ENSMUST00000113927] [ENSMUST00000137853]
Predicted Effect probably benign
Transcript: ENSMUST00000088102
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000085423
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 71 404 9.2e-153 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113925
AA Change: V36A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109558
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 217 1.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113926
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109559
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 404 4.3e-169 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113927
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109560
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 404 4.3e-169 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135661
Predicted Effect possibly damaging
Transcript: ENSMUST00000137853
AA Change: V36A

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118903
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 216 5.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139695
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010]
PHENOTYPE: Male mice hemizygous or female mice homozygous for one knock-out allele exhibit reduced size, viability, and gametes. Another knock-out allele generates mice that exhibit embryonic lethality associated with abnormal extraembryonic tissue and reduction in hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Zfx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3707:Zfx UTSW X 94098807 missense possibly damaging 0.86
R4133:Zfx UTSW X 94080858 missense probably damaging 0.99
Z1088:Zfx UTSW X 94079443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGATGACTGTTTCCGATAC -3'
(R):5'- GCTACTTTTGGGGAGAAGTTGAAC -3'

Sequencing Primer
(F):5'- GATGACTGTTTCCGATACATCTG -3'
(R):5'- GGCATGAGCTTTTGAAACCC -3'
Posted On2015-03-25