Incidental Mutation 'R3764:Ly9'
ID271795
Institutional Source Beutler Lab
Gene Symbol Ly9
Ensembl Gene ENSMUSG00000004707
Gene Namelymphocyte antigen 9
SynonymsT100, CD229, Lgp100, SLAMF3
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171588624-171607410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171594144 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 513 (Y513C)
Ref Sequence ENSEMBL: ENSMUSP00000106908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004827] [ENSMUST00000068878] [ENSMUST00000111277] [ENSMUST00000143463] [ENSMUST00000194797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004827
AA Change: Y403C

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004827
Gene: ENSMUSG00000004707
AA Change: Y403C

DomainStartEndE-ValueType
Pfam:Ig_3 46 116 7.9e-9 PFAM
Pfam:Ig_2 46 129 5.4e-10 PFAM
IG 143 246 1.49e-2 SMART
Pfam:Ig_3 251 320 4.1e-13 PFAM
Pfam:Ig_2 251 330 7.5e-6 PFAM
transmembrane domain 345 364 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068878
AA Change: Y513C

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069319
Gene: ENSMUSG00000004707
AA Change: Y513C

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 5.6e-8 PFAM
Pfam:Ig_2 156 239 4e-8 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5.4e-10 PFAM
low complexity region 433 441 N/A INTRINSIC
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111277
AA Change: Y513C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106908
Gene: ENSMUSG00000004707
AA Change: Y513C

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 9.9e-9 PFAM
Pfam:Ig_2 156 239 6.8e-10 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5e-13 PFAM
Pfam:Ig_2 361 440 9.4e-6 PFAM
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143463
SMART Domains Protein: ENSMUSP00000137924
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Meta Mutation Damage Score 0.1958 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: This locus controls an antigen on thymocytes, lymphocytes and bone marrow cells. The a allele determines Ly9.1 antigen in A/J, 129/Re, BALB/c and C3H/He; the b allele determines antigen Ly9.2 in the C57 family of strains, HTI/Go, MA/My, F/St and C58/Lw. Null mutants are viable, healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Ly9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ly9 APN 1 171593451 missense probably damaging 1.00
IGL00640:Ly9 APN 1 171601879 missense possibly damaging 0.65
IGL01899:Ly9 APN 1 171607247 missense probably damaging 0.99
IGL02714:Ly9 APN 1 171605118 missense possibly damaging 0.60
IGL03086:Ly9 APN 1 171605170 missense probably benign 0.01
R0647:Ly9 UTSW 1 171599808 missense probably damaging 1.00
R1292:Ly9 UTSW 1 171589103 unclassified probably null
R1422:Ly9 UTSW 1 171601212 missense probably damaging 1.00
R1598:Ly9 UTSW 1 171596507 missense probably benign 0.03
R1985:Ly9 UTSW 1 171599773 missense probably damaging 1.00
R2219:Ly9 UTSW 1 171597681 splice site probably null
R2427:Ly9 UTSW 1 171607232 missense probably damaging 0.99
R3815:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3816:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3817:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3819:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R4590:Ly9 UTSW 1 171593875 nonsense probably null
R4653:Ly9 UTSW 1 171594029 missense probably benign 0.41
R4755:Ly9 UTSW 1 171607238 missense probably damaging 0.99
R4871:Ly9 UTSW 1 171607330 intron probably benign
R5167:Ly9 UTSW 1 171605205 missense probably damaging 1.00
R5203:Ly9 UTSW 1 171599779 missense probably damaging 1.00
R5270:Ly9 UTSW 1 171601162 missense probably damaging 0.99
R5692:Ly9 UTSW 1 171605187 frame shift probably null
R5996:Ly9 UTSW 1 171601828 missense probably damaging 1.00
R6389:Ly9 UTSW 1 171596537 missense probably damaging 1.00
R6391:Ly9 UTSW 1 171601008 missense possibly damaging 0.76
R6457:Ly9 UTSW 1 171589095 missense probably damaging 1.00
R6730:Ly9 UTSW 1 171605169 missense probably benign 0.14
R6732:Ly9 UTSW 1 171594085 missense possibly damaging 0.74
R6862:Ly9 UTSW 1 171601155 missense probably benign 0.21
R6866:Ly9 UTSW 1 171605279 missense probably damaging 0.99
R7455:Ly9 UTSW 1 171593939 nonsense probably null
X0062:Ly9 UTSW 1 171605221 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCAATGTCCTGATGGGTGAC -3'
(R):5'- ACTTAAGGTTGCTGGGAAGAC -3'

Sequencing Primer
(F):5'- GGTGACCAAGTCATACACCTGATTTC -3'
(R):5'- CCTAATGGGAAACAGATGTAAATTCC -3'
Posted On2015-03-25