Incidental Mutation 'R3764:Dhx15'
List |< first << previous [record 5 of 26] next >> last >|
ID271806
Institutional Source Beutler Lab
Gene Symbol Dhx15
Ensembl Gene ENSMUSG00000029169
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 15
SynonymsDdx15, HRH2, DBP1, mDEAH9
MMRRC Submission 040741-MU
Accession Numbers

Genbank: NM_001042620, NM_007839; MGI: 1099786

Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52150203-52190514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52166732 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 406 (P406L)
Ref Sequence ENSEMBL: ENSMUSP00000143381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031061] [ENSMUST00000195922] [ENSMUST00000199321] [ENSMUST00000200186]
Predicted Effect probably benign
Transcript: ENSMUST00000031061
AA Change: P406L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031061
Gene: ENSMUSG00000029169
AA Change: P406L

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Pfam:OB_NTP_bind 662 765 3.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195922
SMART Domains Protein: ENSMUSP00000143658
Gene: ENSMUSG00000029169

DomainStartEndE-ValueType
SCOP:d1jpna2 20 149 7e-17 SMART
Blast:AAA 24 186 4e-68 BLAST
PDB:3KX2|A 25 186 4e-65 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199321
AA Change: P406L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143069
Gene: ENSMUSG00000029169
AA Change: P406L

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200186
AA Change: P406L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143381
Gene: ENSMUSG00000029169
AA Change: P406L

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 1.7e-34 SMART
AAA 152 326 1.7e-4 SMART
HELICc 363 477 4.3e-19 SMART
HA2 538 608 4.6e-20 SMART
Meta Mutation Damage Score 0.2702 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Dhx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dhx15 APN 5 52166775 missense probably damaging 1.00
IGL00392:Dhx15 APN 5 52157582 splice site probably benign
IGL00484:Dhx15 APN 5 52166812 missense probably benign
IGL00691:Dhx15 APN 5 52170093 missense probably damaging 1.00
IGL01014:Dhx15 APN 5 52151924 missense probably damaging 1.00
IGL02808:Dhx15 APN 5 52161699 missense possibly damaging 0.95
IGL03408:Dhx15 APN 5 52160312 missense probably damaging 1.00
3-1:Dhx15 UTSW 5 52166697 splice site probably benign
PIT4449001:Dhx15 UTSW 5 52160958 missense probably damaging 0.98
R0021:Dhx15 UTSW 5 52157488 missense probably damaging 0.98
R0133:Dhx15 UTSW 5 52154072 missense possibly damaging 0.61
R0281:Dhx15 UTSW 5 52150746 missense probably benign 0.10
R0566:Dhx15 UTSW 5 52171425 missense probably damaging 1.00
R1827:Dhx15 UTSW 5 52170080 nonsense probably null
R1864:Dhx15 UTSW 5 52184701 missense possibly damaging 0.53
R2106:Dhx15 UTSW 5 52170086 missense probably benign 0.00
R2931:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R2932:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3762:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3948:Dhx15 UTSW 5 52161580 splice site probably benign
R4452:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R5068:Dhx15 UTSW 5 52170067 missense possibly damaging 0.59
R7031:Dhx15 UTSW 5 52184589 missense probably benign 0.03
R7431:Dhx15 UTSW 5 52162611 missense probably damaging 1.00
X0017:Dhx15 UTSW 5 52157490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAGGCAGGTTCCATTCATAACC -3'
(R):5'- CGTGTTGAATGGAATGCATATGAAG -3'

Sequencing Primer
(F):5'- GGTTCCATTCATAACCGAGGCTAG -3'
(R):5'- GGAATGCATATGAAGATGAGTTTTG -3'
Posted On2015-03-25