Incidental Mutation 'R3764:Try10'
ID271808
Institutional Source Beutler Lab
Gene Symbol Try10
Ensembl Gene ENSMUSG00000071521
Gene Nametrypsin 10
Synonymstrypsinogen 10
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41354105-41357914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41356524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 68 (R68C)
Ref Sequence ENSEMBL: ENSMUSP00000071976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072103]
Predicted Effect probably benign
Transcript: ENSMUST00000072103
AA Change: R68C

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071976
Gene: ENSMUSG00000071521
AA Change: R68C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Tryp_SPc 23 239 3.38e-104 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Try10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Try10 APN 6 41356589 missense probably benign 0.00
IGL02608:Try10 APN 6 41355487 missense probably damaging 1.00
IGL03280:Try10 APN 6 41354220 missense probably benign 0.18
R0332:Try10 UTSW 6 41354220 missense probably benign 0.18
R1628:Try10 UTSW 6 41357456 missense probably damaging 1.00
R2149:Try10 UTSW 6 41356561 missense probably benign 0.02
R2471:Try10 UTSW 6 41356746 missense probably damaging 1.00
R4008:Try10 UTSW 6 41356674 missense probably benign 0.00
R4660:Try10 UTSW 6 41357827 missense probably damaging 1.00
R4792:Try10 UTSW 6 41355452 missense probably benign 0.33
R5185:Try10 UTSW 6 41356549 missense probably damaging 0.96
R6103:Try10 UTSW 6 41356550 missense probably damaging 0.98
R6301:Try10 UTSW 6 41355589 missense probably benign 0.30
R6692:Try10 UTSW 6 41357821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCCCACAGCAGTCTTTCATG -3'
(R):5'- ACTCTGGCATTGAGGGTCAC -3'

Sequencing Primer
(F):5'- CCCACCTTTTGAAGCAGAGAG -3'
(R):5'- TCACAGGAGAAGACAGCTTGATC -3'
Posted On2015-03-25