Incidental Mutation 'R3764:Fam57b'
ID271813
Institutional Source Beutler Lab
Gene Symbol Fam57b
Ensembl Gene ENSMUSG00000058966
Gene Namefamily with sequence similarity 57, member B
SynonymsA330104J06Rik, 1500016O10Rik
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3764 (G1)
Quality Score215
Status Validated
Chromosome7
Chromosomal Location126797668-126830219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126827513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 36 (I36T)
Ref Sequence ENSEMBL: ENSMUSP00000145721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061695] [ENSMUST00000079423] [ENSMUST00000098032] [ENSMUST00000205324] [ENSMUST00000205722] [ENSMUST00000207020]
Predicted Effect probably benign
Transcript: ENSMUST00000061695
SMART Domains Protein: ENSMUSP00000049614
Gene: ENSMUSG00000045989

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079423
AA Change: I86T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078392
Gene: ENSMUSG00000058966
AA Change: I86T

DomainStartEndE-ValueType
TLC 34 261 1.2e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098032
AA Change: I86T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095640
Gene: ENSMUSG00000058966
AA Change: I86T

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
TLC 34 261 8.37e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205320
Predicted Effect probably damaging
Transcript: ENSMUST00000205324
AA Change: I86T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205722
AA Change: I86T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205907
Predicted Effect probably damaging
Transcript: ENSMUST00000207020
AA Change: I36T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which may be a likely target of peroxisome proliferator-activated receptor gamma (PPAR-gamma). The product of the orthologous gene in mouse is related to obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Fam57b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Fam57b APN 7 126825003 utr 5 prime probably benign
ishizaka UTSW 7 126827495 missense probably damaging 1.00
tocopherol UTSW 7 126827513 missense probably damaging 1.00
R0421:Fam57b UTSW 7 126825015 missense probably damaging 0.99
R0512:Fam57b UTSW 7 126827623 missense probably damaging 0.99
R1933:Fam57b UTSW 7 126827672 unclassified probably null
R2070:Fam57b UTSW 7 126819840 missense probably benign 0.00
R4998:Fam57b UTSW 7 126827623 missense probably damaging 0.99
R5482:Fam57b UTSW 7 126827488 missense possibly damaging 0.95
R6246:Fam57b UTSW 7 126827496 missense probably damaging 1.00
R7120:Fam57b UTSW 7 126829333 missense probably damaging 0.97
R7159:Fam57b UTSW 7 126827495 missense probably damaging 1.00
X0020:Fam57b UTSW 7 126829275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTTCTGGCATCTGAAACTC -3'
(R):5'- AAGTCTCCTGGCTCCAGAAG -3'

Sequencing Primer
(F):5'- GTTCTGGCATCTGAAACTCAAAACTC -3'
(R):5'- CTGGCTCCAGAAGGAAGGACTC -3'
Posted On2015-03-25