Incidental Mutation 'R3764:Wdr81'
List |< first << previous [record 24 of 26] next >> last >|
ID271816
Institutional Source Beutler Lab
Gene Symbol Wdr81
Ensembl Gene ENSMUSG00000045374
Gene NameWD repeat domain 81
SynonymsMGC32441
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75440944-75454717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75452803 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 546 (T546I)
Ref Sequence ENSEMBL: ENSMUSP00000134266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173320]
Predicted Effect unknown
Transcript: ENSMUST00000117392
AA Change: T545I
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: T545I

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132442
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135804
Predicted Effect probably damaging
Transcript: ENSMUST00000173320
AA Change: T546I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: T546I

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Wdr81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
jello UTSW 11 75441812 missense probably damaging 1.00
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2104:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R4223:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5544:Wdr81 UTSW 11 75441797 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5650:Wdr81 UTSW 11 75444748 missense probably damaging 1.00
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
R6992:Wdr81 UTSW 11 75451786 missense probably benign 0.00
R7148:Wdr81 UTSW 11 75446002 missense
R7340:Wdr81 UTSW 11 75444699 missense probably null
R7739:Wdr81 UTSW 11 75441985 missense
R7823:Wdr81 UTSW 11 75449801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAAATGTCCTCCTGGC -3'
(R):5'- TGCATACCCGAGTTCTACAC -3'

Sequencing Primer
(F):5'- GAAATGTCCTCCTGGCCTGTG -3'
(R):5'- GAGTTCTACACGGACCCCTC -3'
Posted On2015-03-25