Incidental Mutation 'R3764:Zfp40'
ID271822
Institutional Source Beutler Lab
Gene Symbol Zfp40
Ensembl Gene ENSMUSG00000002617
Gene Namezinc finger protein 40
SynonymsNTfin12, Zfp-40
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23173869-23193252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23177127 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 94 (H94L)
Ref Sequence ENSEMBL: ENSMUSP00000121359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037057] [ENSMUST00000140313] [ENSMUST00000172177]
Predicted Effect probably benign
Transcript: ENSMUST00000037057
AA Change: H162L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039794
Gene: ENSMUSG00000002617
AA Change: H162L

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135840
Predicted Effect possibly damaging
Transcript: ENSMUST00000140313
AA Change: H94L

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121359
Gene: ENSMUSG00000002617
AA Change: H94L

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-16 BLAST
ZnF_C2H2 157 179 1.47e-3 SMART
ZnF_C2H2 213 234 5.77e0 SMART
ZnF_C2H2 240 262 4.34e0 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
ZnF_C2H2 295 317 4.24e-4 SMART
ZnF_C2H2 323 345 2.75e-3 SMART
ZnF_C2H2 351 373 1.38e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 8.47e-4 SMART
ZnF_C2H2 463 485 2.57e-3 SMART
ZnF_C2H2 491 513 8.47e-4 SMART
ZnF_C2H2 519 541 4.54e-4 SMART
ZnF_C2H2 547 568 1.26e1 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 3.21e-4 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
ZnF_C2H2 658 680 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142999
Predicted Effect probably benign
Transcript: ENSMUST00000172177
AA Change: H162L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128758
Gene: ENSMUSG00000002617
AA Change: H162L

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Meta Mutation Damage Score 0.6059 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Other mutations in Zfp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Zfp40 APN 17 23175742 missense probably benign 0.18
IGL02664:Zfp40 APN 17 23176986 missense probably benign 0.14
IGL02729:Zfp40 APN 17 23178311 missense probably damaging 0.99
R1288:Zfp40 UTSW 17 23182162 missense probably benign 0.01
R1450:Zfp40 UTSW 17 23175258 missense probably benign 0.15
R1535:Zfp40 UTSW 17 23175869 missense probably damaging 1.00
R1655:Zfp40 UTSW 17 23177266 missense probably benign 0.01
R1797:Zfp40 UTSW 17 23175540 missense possibly damaging 0.93
R2254:Zfp40 UTSW 17 23178370 missense possibly damaging 0.92
R4356:Zfp40 UTSW 17 23177190 missense probably benign 0.15
R4402:Zfp40 UTSW 17 23176719 missense possibly damaging 0.49
R4781:Zfp40 UTSW 17 23175655 missense probably damaging 0.99
R4792:Zfp40 UTSW 17 23177034 missense possibly damaging 0.79
R6142:Zfp40 UTSW 17 23176337 missense probably benign 0.40
R6179:Zfp40 UTSW 17 23178380 missense possibly damaging 0.51
R6759:Zfp40 UTSW 17 23176536 missense possibly damaging 0.95
R7294:Zfp40 UTSW 17 23176437 missense possibly damaging 0.60
R7332:Zfp40 UTSW 17 23176181 nonsense probably null
R7386:Zfp40 UTSW 17 23177007 missense probably damaging 0.96
R7462:Zfp40 UTSW 17 23178388 missense possibly damaging 0.71
R7479:Zfp40 UTSW 17 23177318 missense probably benign 0.23
R7641:Zfp40 UTSW 17 23178283 missense possibly damaging 0.92
R7725:Zfp40 UTSW 17 23178277 missense probably benign 0.38
R7825:Zfp40 UTSW 17 23176327 missense probably benign 0.24
X0022:Zfp40 UTSW 17 23177154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTACACATTCGTTTTATCATGAGTT -3'
(R):5'- TTGCATATGTGGTAAATACGAAGAGGA -3'

Sequencing Primer
(F):5'- GCCAATGATGGAACACAA -3'
(R):5'- AGGACATGGATCAAAGTTCAAATC -3'
Posted On2015-03-25