Incidental Mutation 'R3777:Olfr142'
ID271826
Institutional Source Beutler Lab
Gene Symbol Olfr142
Ensembl Gene ENSMUSG00000075063
Gene Nameolfactory receptor 142
SynonymsGA_x6K02T2Q125-51607674-51606757, K20, MOR227-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3777 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90250130-90257592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90252625 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 121 (Y121C)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
Predicted Effect probably damaging
Transcript: ENSMUST00000099752
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: Y121C

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213968
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Dsg1b G A 18: 20,399,587 V563I probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Fmn1 A G 2: 113,365,122 E389G unknown Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Mypn T C 10: 63,147,982 T496A possibly damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Olfr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01623:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01810:Olfr142 APN 2 90252132 nonsense probably null
IGL01918:Olfr142 APN 2 90252331 missense probably damaging 1.00
IGL02619:Olfr142 APN 2 90252505 missense probably damaging 0.97
IGL02732:Olfr142 APN 2 90252308 missense probably damaging 1.00
IGL02738:Olfr142 APN 2 90252355 missense possibly damaging 0.82
IGL02795:Olfr142 APN 2 90252562 missense probably damaging 1.00
IGL02830:Olfr142 APN 2 90252781 missense probably damaging 1.00
R0601:Olfr142 UTSW 2 90252934 missense probably benign 0.05
R2004:Olfr142 UTSW 2 90252692 missense probably benign 0.04
R2136:Olfr142 UTSW 2 90252253 missense probably damaging 0.98
R2377:Olfr142 UTSW 2 90252911 missense probably damaging 1.00
R3615:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3616:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R4763:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R4765:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R5421:Olfr142 UTSW 2 90252745 missense probably benign 0.01
R5426:Olfr142 UTSW 2 90252611 nonsense probably null
R6063:Olfr142 UTSW 2 90252427 missense probably benign 0.40
R6717:Olfr142 UTSW 2 90252524 missense probably benign 0.00
R6931:Olfr142 UTSW 2 90252777 nonsense probably null
R6936:Olfr142 UTSW 2 90252334 missense probably benign 0.17
R7013:Olfr142 UTSW 2 90252097 missense possibly damaging 0.87
R7091:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R7247:Olfr142 UTSW 2 90252821 missense probably damaging 1.00
R8169:Olfr142 UTSW 2 90252098 nonsense probably null
R8345:Olfr142 UTSW 2 90252217 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGTTGGCCATCACAATAAACCC -3'
(R):5'- CCCTGGTGGAGATCTGTTACTC -3'

Sequencing Primer
(F):5'- CCTCCATAAAGGTGTCAGTGCAG -3'
(R):5'- GGAGATCTGTTACTCCTCTACAATTG -3'
Posted On2015-03-25